Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU064481

Sigma-Aldrich

MISSION® esiRNA

targeting human MEF2A

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TCCTATGATGGCAGTGATCGGGAGGATCCACGGGGCGACTTCCATTCTCCAATTGTGCTTGGCCGACCCCCAAACACTGAGGACAGAGAAAGCCCTTCTGTAAAGCGAATGAGGATGGACGCGTGGGTGACCTAAGGCTTCCAAGCTGATGTTTGTACTTTTGTGTTACTGCAGTGACCTGCCCTACATATCTAAATCGGTAAATAAGGACATGAGTTAAATATATTTATATGTACATACATATATATATCCCTTTACATATATATGTATGTGGGTGTGAGTGTGTATGTGTGGGTGTGTGTTACATACACAGAATCAGGCACTTACCTGCAAACTCCTTGTAGGTCTGCAGATGTGTGTCCCATGGCAGACAAAGCACCCTGTAGGCACAGACAAGTCTGGCACTTCCTTGGACT

Numéro d'accès Ensembl | humain

ENSG00000068305

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... MEF2A(4205) , MEF2A(4205)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Jin-Yong Lee et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 35(1), e21236-e21236 (2020-12-19)
Cadmium (Cd) is an environmental contaminant that causes renal toxicity. We have previously demonstrated that Cd induces renal toxicity by altering transcriptional activities. In this study, we show that Cd markedly inhibited the activity of transcription factor MEF2A in HK-2
Yeyou Liang et al.
Metabolism: clinical and experimental, 64(12), 1682-1693 (2015-10-13)
Evidence shows that both macrophage migration inhibitory factor (MIF) and GLUT4 glucose transporter are involved in diabetic cardiomyopathy (DCM), but it remains largely unknown whether and how MIF regulates GLUT4 expression in cardiomyocytes. The present study aims to investigate the

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique