Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU064451

Sigma-Aldrich

MISSION® esiRNA

targeting human MTMR14

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme

Sélectionner une taille de conditionnement

20 μG
195,00 €
50 μG
345,00 €

195,00 €


Check Cart for Availability


Sélectionner une taille de conditionnement

Changer de vue
20 μG
195,00 €
50 μG
345,00 €

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

195,00 €


Check Cart for Availability

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGTGACACGCATCTTTTTGATAAGGTCAGAGGCTATGACATCAAGCTGCTTCGATACCTGTCAGTCAAATACATCTGTGACCTGATGGTGGAGAACAAGAAGGTGAAGTTTGGCATGAATGTAACCTCCTCTGAGAAGGTGGACAAAGCCCAGCGCTATGCCGACTTCACTCTCCTCTCCATCCCGTATCCAGGCTGTGAATTTTTCAAGGAATATAAAGATCGGGATTACATGGCAGAAGGGCTCATATTTAACTGGAAGCAGGACTACGTTGATGCCCCATTGAGCATCCCCGACTTCCTGACTCACTCTCTGAACATTGACTGGAGCCAGTATCAGTGTTGGGATCTGGTGCAACAAACACAAAACTACCTGAAGCTGCTGCTTTCCTTAGTTAACAGTGATGATGACAGCGG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Zhaodong Li et al.
Gene, 691, 106-113 (2018-12-27)
Myotubularin-related protein 14 (MTMR14) is a member of the myotubularin (MTM)-related protein family and plays a key role in cardiomyopathy and autophagy. However, its potential implication in human cancer is unclear. In this study, we have investigated the expression profile
Jie-Lei Zhang et al.
Cell death & disease, 11(2), 140-140 (2020-02-23)
Cardiac hypertrophy (CH) is an independent risk factor for many cardiovascular diseases, and is one of the primary causes of morbidity and mortality in elderly people. Pathological CH involves excessive protein synthesis, increased cardiomyocyte size, and ultimately the development of
Qichen Pan et al.
Biochemical and biophysical research communications, 529(4), 1045-1052 (2020-08-21)
The phosphoinositide phosphatase, myotubularinrelated protein 14 (MTMR14), plays a critical role in the regulating autophagy. However, its functional contribution to neuronal autophagy is still unclear. In the present study, we attempted to explore the effects of MTMR14 on ischemic stroke

Questions

Évaluations

Aucune valeur de notation

Filtres actifs

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique