Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU061641

Sigma-Aldrich

MISSION® esiRNA

targeting human UVRAG

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCTGAGCACCTCAAACTTCAACTCCAGAAGGAATCCCTAAATGAGCTGAGGAAGGAGTGCACTGCAAAAAGAGAACTCTTCTTGAAGACTAATGCTCAGTTGACAATTCGTTGCAGGCAGTTACTCTCTGAGCTTTCCTACATTTACCCTATTGATTTGAATGAACATAAGGATTACTTTGTATGCGGTGTCAAGTTGCCTAATTCTGAGGACTTCCAAGCAAAAGATGATGGAAGCATTGCTGTTGCCCTTGGTTATACTGCACATCTGGTCTCCATGATTTCCTTTTTCCTACAAGTGCCCCTCAGATATCCTATAATTCATAAGGGGTCTAGATCAACAATCAAAGACAATATCAATGACAAACTGACGGAAAAGGAGAGAGAGTTTCCACTGTATCCAAAAGGAGGGGAGAAGT

Numéro d'accès Ensembl | humain

ENSG00000198382

Numéro d'accès NCBI

NM_003369

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... UVRAG(7405) , UVRAG(7405)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Haoyuan Deng et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 41(6), 2171-2182 (2017-04-26)
Atherosclerosis is a multifactorial chronic disease and is the main cause of death and impairment in the world. Endothelial injury and apoptosis play a crucial role in the onset and development of atherosclerosis. MicroRNAs (miRNAs) have been proven to be
Jianwen Wang et al.
OncoTargets and therapy, 13, 10275-10285 (2020-10-30)
Radiotherapy is one of the most important methods in the treatment of patients with hypopharyngeal squamous cell carcinoma (HSCC). However, radioresistance will be developed after repeated irradiation. Among many key factors contributing to radioresistance, enhanced autophagy is recognized as one
Yunha Kim et al.
Autophagy, 11(5), 796-811 (2015-05-07)
The EWSR1 (EWS RNA-binding protein 1/Ewing Sarcoma Break Point Region 1) gene encodes a RNA/DNA binding protein that is ubiquitously expressed and involved in various cellular processes. EWSR1 deficiency leads to impairment of development and accelerated senescence but the mechanism

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique