Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU061411

Sigma-Aldrich

MISSION® esiRNA

targeting human PLXNB2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTTCTTCCTGCCCTCCAAGGACGGCGACAAGGACGTGATGATCACCGGCAAGCTGGACATCCCTGAGCCGCGGCGGCCGGTGGTGGAGCAGGCCCTCTACCAGTTCTCCAACCTGCTGAACAGCAAGTCTTTCCTCATCAATTTCATCCACACCCTGGAGAACCAGCGGGAGTTCTCGGCCCGCGCCAAGGTCTACTTCGCGTCCCTGCTGACGGTGGCGCTGCACGGGAAACTGGAGTACTACACGGACATCATGCACACGCTCTTCCTGGAGCTCCTGGAGCAGTACGTGGTGGCCAAGAACCCCAAGCTGATGCTGCGCAGGTCTGAGACTGTGGTGGAGAGGATGCTGTCCAACTGGATGTCCATCTGCCTGTACCAGTACCTCAAGGACAGTGCCGGGGAGCCCCTGTACAAGCTCTTCAAGGCCATCAAACATCAGGTGGAAAAGGGCCCGGTGGATGCGGTACAGAAGAAGGC

Numéro d'accès Ensembl | humain

ENSG00000196576

Numéro d'accès NCBI

NM_012401

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... PLXNB2(23654) , PLXNB2(23654)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Ying Zhang et al.
Cellular signalling, 62, 109343-109343 (2019-06-10)
Plexin-B2 (PLXNB2), a transmembrane protein is found in various tissues. Recent studies have indicated the presence of PLXNB2 in large quantity in the growth plates of Sprague-Dawley rats and are believed to be potentially involved in their skeletal development. This
Brad McColl et al.
Journal of cell science, 129(21), 4046-4056 (2016-11-03)
Rnd proteins are atypical members of the Rho GTPase family that induce actin cytoskeletal reorganization and cell rounding. Rnd proteins have been reported to bind to the intracellular domain of several plexin receptors, but whether plexins contribute to the Rnd-induced
Audrey P Le et al.
Oncotarget, 6(9), 7293-7304 (2015-03-13)
Invasive growth is a major determinant of the high lethality of malignant gliomas. Plexin-B2, an axon guidance receptor important for mediating neural progenitor cell migration during development, is upregulated in gliomas, but its function therein remains poorly understood. Combining bioinformatic
Daisuke Ito et al.
Journal of immunology (Baltimore, Md. : 1950), 195(3), 934-943 (2015-06-28)
Mammalian target of rapamycin (mTOR) plays crucial roles in activation and differentiation of diverse types of immune cells. Although several lines of evidence have demonstrated the importance of mTOR-mediated signals in CD4(+) T cell responses, the involvement of mTOR in

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique