Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU059261

Sigma-Aldrich

MISSION® esiRNA

targeting human TFEB

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCGGCAGAAGAAAGACAATCACAACTTAATTGAAAGGAGACGAAGGTTCAACATCAATGACCGCATCAAGGAGTTGGGAATGCTGATCCCCAAGGCCAATGACCTGGACGTGCGCTGGAACAAGGGCACCATCCTCAAGGCCTCTGTGGATTACATCCGGAGGATGCAGAAGGACCTGCAAAAGTCCAGGGAGCTGGAGAACCACTCTCGCCGCCTGGAGATGACCAACAAGCAGCTCTGGCTCCGTATCCAGGAGCTGGAGATGCAGGCTCGAGTGCACGGCCTCCCTACCACCTCCCCGTCCGGCATGAACATGGCTGAGCTGGCCCAGCAGGTGGTGAAGCAGGAGCTGCCTAGCGAAGAGGGCCCAGGGGAGGCCCTGATGCTGGGGGCTGAGGTCCCTGACCCTGAGCCACTGCCAGCTCTGCCCCCGCAAGCCCCGCTGCCCCTGCCCACCCAGCCACCATCCCCATTCCATCACCTGGACTTCAGCCAC

Numéro d'accès Ensembl | humain

ENSG00000112561

Numéro d'accès NCBI

NM_007162

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... TFEB(7942) , TFEB(7942)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Sijie Tan et al.
Scientific reports, 9(1), 727-727 (2019-01-27)
Mitochondrial dysfunction underscores aging and diseases. Mitophagy (mitochondria + autophagy) is a quality control pathway that preserves mitochondrial health by targeting damaged mitochondria for autophagic degradation. Hence, molecules or compounds that can augment mitophagy are therapeutic candidates to mitigate mitochondrial-related diseases. However
Valeria Crippa et al.
Scientific reports, 6, 22827-22827 (2016-03-11)
Neurodegenerative diseases (NDs) are often associated with the presence of misfolded protein inclusions. The chaperone HSPB8 is upregulated in mice, the human brain and muscle structures affected during NDs progression. HSPB8 exerts a potent pro-degradative activity on several misfolded proteins
Samuel Peña-Llopis et al.
The EMBO journal, 30(16), 3242-3258 (2011-08-02)
Mammalian target of rapamycin (mTOR) complex 1 (mTORC1) is an important, highly conserved, regulator of cell growth. Ancient among the signals that regulate mTORC1 are nutrients. Amino acids direct mTORC1 to the surface of the late endosome/lysosome, where mTORC1 becomes
Xingchen Zhao et al.
The Journal of pathology, 245(2), 235-248 (2018-03-24)
Insufficient autophagy in podocytes is related to podocyte injury in diabetic nephropathy (DN). Advanced glycation end-products (AGEs) are major factors of podocyte injury in DN. However, the role and mechanism of AGEs in autophagic dysfunction remain unknown. We investigated autophagic
Hong-Ying Chu et al.
Cancer letters, 423, 105-112 (2018-03-11)
The role of autophagy in tongue squamous cell carcinoma (TSCC) cisplatin resistance is unclear. We aimed to identify a possible synergistic effect of autophagy inhibitors and cisplatin in TSCC cells and explore the underlying mechanism. Our results indicate that autophagic
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique