Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU054171

Sigma-Aldrich

MISSION® esiRNA

targeting human PTPN14

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TTCGCTAATGAGCCTTTGCTTTTCTTTGGAGTCATGTTCTATGTGCCAAATGTGTCATGGCTTCAGCAAGAGGCCACAAGATATCAGTATTACCTGCAAGTCAAAAAAGATGTGCTTGAAGGGCGATTACGATGTACATTGGACCAGGTGATTCGGCTAGCCGGCCTAGCTGTGCAAGCTGATTTTGGAGACTATAATCAGTTTGATTCTCAAGATTTCCTCAGAGAGTATGTGCTATTTCCTATGGATTTGGCCCTGGAAGAGGCTGTTCTGGAGGAGCTGACCCAGAAGGTAGCCCAAGAACACAAAGCCCACAGTGGAATCCTGCCAGCAGAAGCTGAACTGATGTACATCAATGAAGTTGAACGTTTGGATGGATTTGGACAGGAAATCTTCCCTG

Numéro d'accès Ensembl | humain

ENSG00000152104

Numéro d'accès NCBI

NM_005401

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... PTPN14(5784) , PTPN14(5784)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Ana Lonic et al.
The Journal of cell biology, 220(2) (2021-01-08)
Receptor degradation terminates signaling by activated receptor tyrosine kinases. Degradation of EGFR occurs in lysosomes and requires the switching of RAB5 for RAB7 on late endosomes to enable their fusion with the lysosome, but what controls this critical switching is
Natalia I Díaz-Valdivia et al.
Oncogene, 39(18), 3693-3709 (2020-03-11)
Caveolin-1 (CAV1) enhanced migration, invasion, and metastasis of cancer cells is inhibited by co-expression of the glycoprotein E-cadherin. Although the two proteins form a multiprotein complex that includes β-catenin, it remained unclear how this would contribute to blocking the metastasis
Yujie Yang et al.
British journal of pharmacology, 178(7), 1524-1540 (2021-01-22)
Disturbed flow induces endothelial dysfunction and contributes to uneven distribution of atherosclerotic plaque. Emerging evidence suggests that harmine, a natural constituent of extracts of Peganum harmala, has potent beneficial activities. Here, we investigated if harmine has an atheroprotective role under

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique