Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU053851

Sigma-Aldrich

MISSION® esiRNA

targeting human PROX1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme

Sélectionner une taille de conditionnement

20 μG
195,00 €
50 μG
345,00 €

195,00 €


Date d'expédition estimée le15 mai 2025



Sélectionner une taille de conditionnement

Changer de vue
20 μG
195,00 €
50 μG
345,00 €

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

195,00 €


Date d'expédition estimée le15 mai 2025


Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGCTCTCCTTGTCGCTCATAAAGTCCGAGTGCGGCGATCTTCAAGATATGTCTGAAATATCACCTTATTCGGGAAACTCTATGGAGGAAGGATTGTCACCCAATCACTTGAAAAAAGCAAAGCTCATGTTTTTTTATACCCGTTATCCCAGCTCCAATATGCTGAAGACCTACTTCTCCGACGTAAAGTTCAACAGATGCATTACCTCTCAGCTCATCAAGTGGTTTAGCAATTTCCGTGAGTTTTACTACATTCAGATGGAGAAGTACGCACGTCAAGCCATCAACGATGGGGTCACCAGTACTGAAGAGCTGTCTATAACCAGAGACTGTGAGCTGTACAGGGCTCTGAACATGCACTACAATAAAGCAAATGACTTTGAGGTTCCAGAGAGATTCCTGGAAGTTGCTCAGATCACATTACGGGAGTTTTTCAATGCCATTATCGCA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Chang Rae Rho et al.
Investigative ophthalmology & visual science, 56(10), 5871-5879 (2015-09-09)
Prospero homeobox 1 (Prox1) siRNA is a small interfering RNA that is designed to specifically bind Prox1 mRNA. We determined whether Prox1 siRNA inhibits lymphangiogenesis and hemangiogenesis after acute corneal inflammation. Three Prox1 siRNAs were synthesized and investigated for their
Kang-Jin Park et al.
Gastric cancer : official journal of the International Gastric Cancer Association and the Japanese Gastric Cancer Association, 20(1), 104-115 (2016-01-14)
Prospero homeobox 1 (PROX1) functions as a tumor suppressor gene or an oncogene in various cancer types. However, the distinct function of PROX1 in gastric cancer is unclear. We determined whether PROX1 affected the oncogenic behavior of gastric cancer cells
Toshihiko Goto et al.
FEBS letters, 591(4), 624-635 (2017-01-28)
Previous reports have revealed that Prospero-related homeobox 1 (Prox1) is required for the migration and differentiation of hepatoblasts during embryonic liver formation. However, the role of Prox1 in adults remains to be elucidated. We created liver-specific Prox1 knockout mice to
Tomonori Sasahira et al.
PloS one, 9(3), e92534-e92534 (2014-03-22)
Prospero homeobox 1 (Prox1) and forkhead box (FOX) C2 regulate angiogenesis and/or lymphangiogenesis. However, the detailed role and function of Prox1 and FOXC2 in cancer remains controversial. In the present study, we examined the expression of Prox1 and FOXC2 proteins
René Hägerling et al.
The EMBO journal, 32(5), 629-644 (2013-01-10)
During mammalian development, a subpopulation of endothelial cells in the cardinal vein (CV) expresses lymphatic-specific genes and subsequently develops into the first lymphatic structures, collectively termed as lymph sacs. Budding, sprouting and ballooning of lymphatic endothelial cells (LECs) have been

Questions

Évaluations

Aucune valeur de notation

Filtres actifs

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique