Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU051991

Sigma-Aldrich

MISSION® esiRNA

targeting human MAP3K8

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme

Sélectionner une taille de conditionnement

20 μG
195,00 €
50 μG
345,00 €

195,00 €


Date d'expédition estimée le18 mai 2025



Sélectionner une taille de conditionnement

Changer de vue
20 μG
195,00 €
50 μG
345,00 €

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

195,00 €


Date d'expédition estimée le18 mai 2025


Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GAAGAAGCCAGGGGAATAGGTAGCCACATCTTGTTTGCAGATAAGAAAGGAAGCTAACGCAGTATCTGCAAAGCCAGGAGTCTGACTCAGTACTTTTCTCACTCATGCATACAAAGCAGCTAAAAATGACACAGCTTATTTACCATGCCCCTGACACTGCACTGAGCACTTTATGAGCTTGAACTCTGTTAATCCTCACGACCACCTCATGAGACTCTCCAGAAAGAGCAACAGTAATGGAGTACATGAGCACTGGAAGTGACAATAAAGAAGAGATTGATTTATTAATTAAACATTTAAATGTGTCTGATGTAATAGACATTATGGAAAATCTTTATGCAAGTGAAGAGCCAGCAGTTTATGAACCCAGTCTAATGACCATGTGTCAAGACAGTAATCAAAACGATGAGCGTTCTAAGTCTCTGCTGCTTAGTGGCCAAGAGGTACCATG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Wayne Huey-Herng Sheu et al.
Arteriosclerosis, thrombosis, and vascular biology, 41(1), e46-e62 (2020-11-13)
Diabetic retinopathy, one of retinal vasculopathy, is characterized by retinal inflammation, vascular leakage, blood-retinal barrier breakdown, and neovascularization. However, the molecular mechanisms that contribute to diabetic retinopathy progression remain unclear. Approach and Results: Tpl2 (tumor progression locus 2) is a
Stefanie Voigt et al.
Nature communications, 11(1), 685-685 (2020-02-06)
IκB kinase 2 (IKK2) is well known for its pivotal role as a mediator of the canonical NF-κB pathway, which has important functions in inflammation and immunity, but also in cancer. Here we identify a novel and critical function of
D C Kanellis et al.
Oncogene, 34(19), 2516-2526 (2014-07-08)
Tumor Progression Locus 2 (TPL2) is widely recognized as a cytoplasmic mitogen-activated protein 3 kinase with a prominent role in the regulation of inflammatory and oncogenic signal transduction. Herein we report that TPL2 may also operate in the nucleus as

Questions

Évaluations

Aucune valeur de notation

Filtres actifs

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique