Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU051511

Sigma-Aldrich

MISSION® esiRNA

targeting human LNPK

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme

Sélectionner une taille de conditionnement

20 μG
195,00 €
50 μG
345,00 €

195,00 €


Check Cart for Availability


Sélectionner une taille de conditionnement

Changer de vue
20 μG
195,00 €
50 μG
345,00 €

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

195,00 €


Check Cart for Availability

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TTTGAGAAGAGGCAGGTGGTGGAAGGTTCAAGTTCAGTTGGTCCCTTGCCATCAGGAAGTGTGCTTTCATCAGACAACCAGTTTAATGAAGAATCTTTAGAACACGATGTTCTTGATGATAATACAGAGCAGACAGATGACAAAATACCAGCTACAGAACAGACAAACCAAGTGATTGAAAAAGCATCTGACTCAGAGGAACCAGAGGAGAAACAAGAGACTGAGAATGAGGAAGCCTCAGTGATTGAAACCAACTCCACAGTTCCTGGAGCTGATTCTATTCCTGATCCTGAACTAAGTGGAGAATCTTTGACGGCAGAGTAGTAAATGCTTCCACGTGCCTTCAACTGGATATTTATAGTCTTACTGATGTCAGTTATTGCTTTTTCGGTGGCACTTAC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Jian-Bin Qiao et al.
Journal of controlled release : official journal of the Controlled Release Society, 321, 629-640 (2020-03-07)
Liver fibrosis leads to over one million deaths annually worldwide. Hepatic stellate cells (HSCs) have been identified as the main executors of liver fibrosis. Unfortunately, no drug has yet been approved for clinical use against liver fibrosis, largely because the
Genc Basha et al.
Molecular therapy. Nucleic acids, 5(9), e363-e363 (2016-09-14)
Sclerostin is a protein secreted by osteocytes that is encoded by the SOST gene; it decreases bone formation by reducing osteoblast differentiation through inhibition of the Wnt signaling pathway. Silencing the SOST gene using RNA interference (RNAi) could therefore be
Kaishun Zhao et al.
Aging, 12(10), 9125-9138 (2020-05-29)
Inflammation is an important cause of chronic obstructive pulmonary disease (COPD) and its acute exacerbation. However, the critical role of C-C chemokine receptor (CCR)1 in progression of cigarette smoke-induced chronic inflammation remains unclear. We studied CCR1 expression using immunohistochemistry, immunofluorescence
Kasra Khalaj et al.
Scientific reports, 7(1), 5883-5883 (2017-07-21)
Endometriosis, a major reproductive pathology affecting 8-10% of women is characterized by chronic inflammation and immune dysfunction. Human antigen R (HuR) and Tristetraprolin (TTP) are RNA binding proteins that competitively bind to cytokines involved in inflammation including: tumor necrosis factor
Ayaka Okamoto et al.
Biochemical and biophysical research communications, 449(4), 460-465 (2014-05-24)
An Fab' antibody against heparin-binding epidermal growth factor-like growth factor (HB-EGF) was applied to achieve advanced tumor-targeted delivery of siRNA. Lipid nanoparticles (LNP) encapsulating siRNA (LNP-siRNA) were prepared, pegylated, and surface modified with Fab' fragments of anti-HB-EGF antibody (αHB-EGF LNP-siRNA).

Questions

Évaluations

Aucune valeur de notation

Filtres actifs

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique