Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU050111

Sigma-Aldrich

MISSION® esiRNA

targeting human PBK

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGACCCTGAGGCTTGTTACATTGGCACAGAGCCATGGAAACCCAAAGAAGCTGTGGAGGAGAATGGTGTTATTACTGACAAGGCAGACATATTTGCCTTTGGCCTTACTTTGTGGGAAATGATGACTTTATCGATTCCACACATTAATCTTTCAAATGATGATGATGATGAAGATAAAACTTTTGATGAAAGTGATTTTGATGATGAAGCATACTATGCAGCGTTGGGAACTAGGCCACCTATTAATATGGAAGAACTGGATGAATCATACCAGAAAGTAATTGAACTCTTCTCTGTATGCACTAATGAAGACCCTAAAGATCGTCCTTCTGCTGCACACATTGTTGAAGCTCTGGAAACAGATGTCTAGTGATCATCTCAGCTGAAGTGTGGCTTGCGTAA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

D Herrero-Martín et al.
British journal of cancer, 101(1), 80-90 (2009-06-06)
Ewing sarcoma is a paradigm of solid tumour -bearing chromosomal translocations resulting in fusion proteins that act as deregulated transcription factors. Ewing sarcoma translocations fuse the EWS gene with an ETS transcription factor, mainly FLI1. Most of the EWS-FLI1 target
Jia-Hong Chen et al.
International journal of biological macromolecules, 81, 615-623 (2015-09-01)
Roles and mechanisms of cell cycle-specific transcription factor E2F1 on prostate cancer (PCa) have not been fully elucidated. To address this problem, we here identified PDZ-binding kinase (PBK) as a direct target for E2F1 through bioinformatics binding site prediction, combined
Young-Ju Lee et al.
Biochemical and biophysical research communications, 530(1), 122-129 (2020-08-24)
TGF-β1 is known to induce epithelial-mesenchymal transition (EMT), which is a prerequisite for cancer cell invasion. Here we reveal that TOPK upregulates EMT and invasion of human breast cancer MDA-MB-231 or Hs578T cells via NF-κB-dependent Snail/Slug in TGF-β1 signaling. Endogenous
Joshua D Brown-Clay et al.
Oncotarget, 6(17), 15594-15609 (2015-04-25)
A current challenge in prostate cancer treatment is how to differentiate aggressive disease from indolent prostate cancer. There is an urgent need to identify markers that would accurately distinguish indolent prostate cancer from aggressive disease. The aim of this study
Gen Wang et al.
Breast cancer research and treatment, 175(3), 567-578 (2019-04-03)
In early stage, ERα-positive breast cancer, concurrent use of endocrine therapy and chemotherapy has not been shown to be superior to sequential use. We hypothesized that genetic biomarkers can aid in selecting patients who would benefit from chemo-endocrine therapy. Our

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique