Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU049311

Sigma-Aldrich

MISSION® esiRNA

targeting human UNC5D

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51
Le tarif et la disponibilité ne sont pas disponibles actuellement.

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCAGAGCTCGTTCATGGTTTCCCTGGGAGTGTCTGAGAGAGCTGAGTACCACGGCAAGAATCATTCCAGGACTTTTCCCCATGGAAACAACCACAGCTTTAGTACAATGCATCCCAGAAATAAAATGCCCTACATCCAAAATCTGTCATCACTCCCCACAAGGACAGAACTGAGGACAACTGGTGTCTTTGGCCATTTAGGGGGGCGCTTAGTAATGCCAAATACAGGGGTGAGCTTACTCATACCACACGGTGCCATCCCAGAGGAGAATTCTTGGGAGATTTATATGTCCATCAACCAAGGTGAACCCAGCCTCCAGTCAGATGGCTCTGAGGTGCTCCTGAGTCCTGAAGTCACCTGTGGTCCTCCAGACATGATCGTCACCACTCCCTTTGCATTGAC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yuyan Zhu et al.
The Journal of urology, 192(2), 575-582 (2014-02-13)
Identifying potential targets would improve therapeutic planning and disease management. Therefore, we investigated whether the novel identified dependence receptor UNC5D acts as a tumor suppressor in bladder malignancies. We assessed the UNC5D level in a panel of 15 primary bladder carcinomas
Priya Srikanth et al.
Translational psychiatry, 8(1), 245-245 (2018-11-10)
The identification of convergent phenotypes in different models of psychiatric illness highlights robust phenotypes that are more likely to be implicated in disease pathophysiology. Here, we utilize human iPSCs harboring distinct mutations in DISC1 that have been found in families

Questions

Évaluations

Aucune valeur de notation

Filtres actifs

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique