Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU048531

Sigma-Aldrich

MISSION® esiRNA

targeting human VAV1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGCCACATGTTCCTCCTGATCGAGGACCAAGGTGCCCAGGGCTATGAGCTGTTCTTCAAGACAAGAGAATTGAAGAAGAAGTGGATGGAGCAGTTTGAGATGGCCATCTCCAACATCTATCCGGAGAATGCCACCGCCAACGGGCATGACTTCCAGATGTTCTCCTTTGAGGAGACCACATCCTGCAAGGCCTGTCAGATGCTGCTTAGAGGTACCTTCTATCAGGGCTACCGCTGCCATCGGTGCCGGGCATCTGCACACAAGGAGTGTCTGGGGAGGGTCCCTCCATGTGGCCGACATGGGCAAGATTTCCCAGGAACTATGAAGAAGGACAAACTACATCGCAGGGCTCAGGACAAAAAGAGGAATGAGCTGGGTCTGCCCAAGATGGAGGTGTTTCAGGAATACTACGGGCTTCCTCCACCCCCTGGAGCCATTGGACCCTTTCTACGGCT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Ying Zhou et al.
Journal of cellular biochemistry, 119(7), 5437-5448 (2018-01-26)
This study aims to explore the effect of miR-330 targeting VAV1 on amyloid β-protein (Aβ) production, oxidative stress (OS), and mitochondrial dysfunction in Alzheimer's disease (AD) mice through the MAPK signaling pathway. Putative targeted gene of miR-330 was performed by
Guillaume Gaud et al.
Science signaling, 11(538) (2018-07-12)
The activation of T cells requires the guanine nucleotide exchange factor VAV1. Using mice in which a tag for affinity purification was attached to endogenous VAV1 molecules, we analyzed by quantitative mass spectrometry the signaling complex that assembles around activated
Arathi Nair et al.
Cell communication and signaling : CCS, 18(1), 3-3 (2020-01-08)
Ras are small cellular GTPases which regulate diverse cellular processes. It has three isoforms: H-Ras, K-Ras, and N-Ras. Owing to the N-terminus (1-165 residues) sequence homology these isoforms were thought to be functionally redundant. However, only K-Ras-deficient mice but not
Silvia Grassilli et al.
Oncotarget, 5(12), 4320-4336 (2014-06-26)
Vav1 is one of the signalling proteins normally restricted to hematopoietic cells that results ectopically expressed in solid tumors, including breast cancer. By immunohistochemical analysis on TMAs containing invasive breast tumor from patients without lymph node involvement, we have found

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique