Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU048191

Sigma-Aldrich

MISSION® esiRNA

targeting human SNAI2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme

Sélectionner une taille de conditionnement

20 μG
195,00 €
50 μG
345,00 €

195,00 €

Check Cart for Availability
Toutes les photos(1)

Sélectionner une taille de conditionnement

Changer de vue
20 μG
195,00 €
50 μG
345,00 €

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

195,00 €

Check Cart for Availability

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TCGGACCCACACATTACCTTGTGTTTGCAAGATCTGCGGCAAGGCGTTTTCCAGACCCTGGTTGCTTCAAGGACACATTAGAACTCACACGGGGGAGAAGCCTTTTTCTTGCCCTCACTGCAACAGAGCATTTGCAGACAGGTCAAATCTGAGGGCTCATCTGCAGACCCATTCTGATGTAAAGAAATACCAGTGCAAAAACTGCTCCAAAACCTTCTCCAGAATGTCTCTCCTGCACAAACATGAGGAATCTGGCTGCTGTGTAGCACACTGAGTGACGCAATCAATGTTTACTCGAACAGAATGCATTTCTTCACTCCGAAGCCAAATGACAAATAAAGTCCAAAGGCATTTTCTCCTGTGCTGACCAACCAAATAATATGTATAGACACACACACATATGCACACACACACACACACACCCACAGAGAGAGAGCTGCAAGAGCATGGAATTCA

Numéro d'accès Ensembl | humain

ENSG00000019549

Numéro d'accès NCBI

NM_003068

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... SNAI2(6591) , SNAI2(6591)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
TOU
MHU
OFU
PZT
TXT

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Dong Hyun Jo et al.
Oncotarget, 8(9), 15441-15452 (2017-01-07)
Retinoblastoma is the most common intraocular cancer in children, affecting 1/20,000 live births. Currently, children with retinoblastoma were treated with chemotherapy using drugs such as carboplatin, vincristine, and etoposide. Unfortunately, if conventional treatment fails, the affected eyes should be removed
Wenyang Li et al.
Genes & development, 34(19-20), 1310-1315 (2020-09-19)
SNAI2/SLUG, a metastasis-promoting transcription factor, is a labile protein that is degraded through the ubiquitin proteasome degradation system. Here, we conducted comprehensive gain- and loss-of-function screens using a human DUB cDNA library of 65 genes and an siRNA library of
Adrián Blanco-Gómez et al.
Cancer research, 80(23), 5216-5230 (2020-10-08)
SNAI2 overexpression appears to be associated with poor prognosis in breast cancer, yet it remains unclear in which breast cancer subtypes this occurs. Here we show that excess SNAI2 is associated with a poor prognosis of luminal B HER2+/ERBB2+ breast
Mijung Kwon et al.
Oncotarget, 7(47), 77052-77070 (2016-10-25)
Filamin A interacting protein 1-like (FILIP1L) is an inhibitor of the canonical WNT pathway. WNT/β-catenin signaling and its downstream pathway, epithelial-to-mesenchymal transition (EMT), play a key role in ovarian cancer metastasis and chemoresistance. To study the clinical implications of FILIP1L
Carla L Alves et al.
Breast cancer research : BCR, 20(1), 60-60 (2018-06-21)
Endocrine resistance in estrogen receptor-positive (ER+) breast cancer is a major clinical problem and is associated with accelerated cancer cell growth, increased motility and acquisition of mesenchymal characteristics. However, the specific molecules and pathways involved in these altered features remain
Afficher tous les articles scientifiques apparentés

Questions

Évaluations

Aucune valeur de notation

Filtres actifs

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique