Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU043351

Sigma-Aldrich

MISSION® esiRNA

targeting human H6PD

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TAATCCTGCTGGGAGCAACTGGGGACCTGGCTAAGAAGTACTTATGGCAGGGACTGTTCCAGCTGTACCTGGATGAAGCGGGGAGGGGTCACAGTTTTAGCTTCCATGGAGCTGCTCTGACAGCCCCCAAGCAGGGTCAAGAGCTCATGGCCAAGGCCCTGGAATCCCTCTCCTGCCCCAAGGACATGGCACCCAGTCACTGTGCAGAGCACAAGGATCAGTTCCTGCAGCTGAGCCAGTACCGCCAACTGAAGACGGCCGAGGACTATCAGGCCCTGAACAAGGACATCGAGGCACAGCTCCAGCACGCAGGCCTCCGGGAGGCTGGCAGGATCTTCTACTTCTCAGTGCCACCCTTCGCCTATGAAGACATTGCCCGCAACATCAACAGTAGCTGCCGGCCAGGCCCGGGCGCCTGGCTGCGGGTTGTCCTTGAGAAACCCTTTGGCCATGACCACTTCT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Maria Tsachaki et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 32(5), 2690-2705 (2018-01-04)
Hexose-6-phosphate dehydrogenase (H6PD) produces reduced NADPH in the endoplasmic reticulum (ER) lumen. NADPH constitutes a cofactor for many reducing enzymes, and its inability to traverse biologic membranes makes in situ synthesis of NADPH in the ER lumen indispensable. The H6PD
Giuseppe Lucarelli et al.
Oncotarget, 6(15), 13371-13386 (2015-05-07)
The analysis of cancer metabolome has shown that proliferating tumor cells require a large quantities of different nutrients in order to support their high rate of proliferation. In this study we analyzed the metabolic profile of glycolysis and the pentose

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique