Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU041261

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC31A1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TTTCCGGTTTGGTGATCAATACAGCTGGAGAAATGGCTGGAGCTTTTGTGGCAGTGTTTTTACTAGCAATGTTCTATGAAGGACTCAAGATAGCCCGAGAGAGCCTGCTGCGTAAGTCACAAGTCAGCATTCGCTACAATTCCATGCCTGTCCCAGGACCAAATGGAACCATCCTTATGGAGACACACAAAACTGTTGGGCAACAGATGCTGAGCTTTCCTCACCTCCTGCAAACAGTGCTGCACATCATCCAGGTGGTCATAAGCTACTTCCTCATGCTCATCTTCATGACCTACAACGGGTACCTCTGCATTGCAGTAGCAGCAGGGGCCGGTACAGGATACTTCCTCTTCAGCTGGAAGAAGGCAGTGGTAGTGGATATCACAGAGCATTGCCATTGACATCAA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

De-Hai Gou et al.
Redox biology, 38, 101795-101795 (2020-11-25)
The formation of α-synuclein aggregates is a major pathological hallmark of Parkinson's disease. Copper promotes α-synuclein aggregation and toxicity in vitro. The level of copper and copper transporter 1, which is the only known high-affinity copper importer in the brain
Shun Li et al.
Scientific reports, 5, 12410-12410 (2015-07-16)
Copper, a strictly regulated trace element, is essential for many physiological processes including angiogenesis. Dysregulated angiogenesis has been associated with increased copper in tumors, and thus copper chelators have been used to inhibit tumor angiogenesis. However, it remains unclear whether
Xuemin Wang et al.
PloS one, 10(4), e0125402-e0125402 (2015-05-01)
Cisplatin is one of the first-line platinum-based chemotherapeutic agents for treatment of many types of cancer, including ovary cancer. CTR1 (copper transporter 1), a transmembrane solute carrier transporter, has previously been shown to increase the cellular uptake and sensitivity of

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique