Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU039111

Sigma-Aldrich

MISSION® esiRNA

targeting human LPAR4

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TTTGAAGGCTTCTCCAAACGTGTCTGGAAGACTTATTTATCCAAGATCACAATATTTATTGAAGTTGTTGGGTTTATCATTCCTCTAATATTGAATGTCTCTTGCTCTTCTGTGGTGCTGAGAACTCTTCGCAAGCCTGCTACTCTGTCTCAAATTGGGACCAATAAGAAAAAAGTACTGAAAATGATCACAGTACATATGGCAGTCTTTGTGGTATGCTTTGTACCCTACAACTCTGTCCTCTTCTTGTATGCCCTGGTGCGCTCCCAAGCTATTACTAATTGCTTTTTGGAAAGATTTGCAAAGATCATGTACCCAATCACCTTGTGCCTTGCAACTCTGAACTGTTGTTTTGACCCTTTCATCTATTACTTCACCCTTGAATCCTTTCAGAAGTCCTTCTACATCAATGCCCACATCAGAATGGAGTCCCTGTTTAAGACTGAAACACCTTTGACCACAAAGCC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Chen Jiang et al.
Journal of cellular biochemistry, 119(8), 6429-6441 (2017-12-15)
The study explores whether miR-139-5p targeting LPAR4 affects epithelial-mesenchymal transition (EMT) and fibrosis in post-menopausal women with interstitial cystitis (IC) via the PI3K/Akt signaling pathway. Bladder tissues of IC and normal bladder tissues were collected. The pathology of bladder tissues
Nobuhiro Kurabayashi et al.
Development (Cambridge, England), 145(17) (2018-09-16)
Newborn neurons in the developing neocortex undergo radial migration, a process that is coupled with their precise passage from multipolar to bipolar shape. The cell-extrinsic signals that govern this transition are, however, poorly understood. Here, we find that lysophosphatidic acid

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique