Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU038131

Sigma-Aldrich

MISSION® esiRNA

targeting human FGF9

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme

Sélectionner une taille de conditionnement

20 μG
195,00 €
50 μG
345,00 €

195,00 €

Date d'expédition estimée le30 mai 2025

Toutes les photos(1)

Sélectionner une taille de conditionnement

Changer de vue
20 μG
195,00 €
50 μG
345,00 €

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

195,00 €

Date d'expédition estimée le30 mai 2025

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GAACCAGGAAAGACCACAGCCGATTTGGCATTCTGGAATTTATCAGTATAGCAGTGGGCCTGGTCAGCATTCGAGGCGTGGACAGTGGACTCTACCTCGGGATGAATGAGAAGGGGGAGCTGTATGGATCAGAAAAACTAACCCAAGAGTGTGTATTCAGAGAACAGTTCGAAGAAAACTGGTATAATACGTACTCATCAAACCTATATAAGCACGTGGACACTGGAAGGCGATACTATGTTGCATTAAATAAAGATGGGACCCCGAGAGAAGGGACTAGGACTAAACGGCACCAGAAATTCACACATTTTTTACCTAGACCAGTGGACCCCGACAAAGTACCTGAACTGTATAAGGATATTCTAAGCCAAAGTTGACAAAGACAGTTTCTTCACTTGAGCCCTTAAAAAAGTAACCACTATAAAGGTTTCACGCGGTGGGTTCTTATTGATTCGCTGTGTCATCACA

Numéro d'accès Ensembl | humain

ENSG00000102678

Numéro d'accès NCBI

NM_002010

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... FGF9(2254) , FGF9(2254)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

Si vous avez besoin d'assistance, veuillez contacter Service Clients

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Zhijin Zhang et al.
Experimental and therapeutic medicine, 19(3), 1711-1718 (2020-02-28)
Development of cisplatin resistance in colorectal cancer is largely caused by dysregulation of signaling pathways, including the Wnt/β-catenin signaling pathway, in cancer cells. Further investigation into the molecular mechanism of chemoresistance could improve outcomes for patients with colorectal cancer. The
Longhao Li et al.
Biology open, 9(5) (2020-05-06)
Tumor metastasis is the main contributor to high recurrence and mortality in colorectal cancer (CRC). In a previous study, we found that DJ-1 plays an important role in CRC metastasis, and is the main target in Ciclopirox olamine (CPX)-treated CRC.
Wei Wang et al.
Oncology letters, 19(1), 1001-1007 (2020-01-04)
Breast cancer has become an important public health problem. Moreover, the functions of microRNA-431 (miR-431) have been detected in human cancers other than breast cancer. Hence, we investigated the role of miR-431 in progression of breast cancer. RT-qPCR and Western

Questions

Évaluations

Aucune valeur de notation

Filtres actifs

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique