Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU034511

Sigma-Aldrich

MISSION® esiRNA

targeting human TBK1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme

Sélectionner une taille de conditionnement

20 μG
195,00 €
50 μG
345,00 €

195,00 €

Check Cart for Availability
Toutes les photos(1)

Sélectionner une taille de conditionnement

Changer de vue
20 μG
195,00 €
50 μG
345,00 €

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

195,00 €

Check Cart for Availability

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCCGGCTGGTATAACAAGAGGATTGCCTGATCCAGCCAAGATGCAGAGCACTTCTAATCATCTGTGGCTTTTATCTGATATTTTAGGCCAAGGAGCTACTGCAAATGTCTTTCGTGGAAGACATAAGAAAACTGGTGATTTATTTGCTATCAAAGTATTTAATAACATAAGCTTCCTTCGTCCAGTGGATGTTCAAATGAGAGAATTTGAAGTGTTGAAAAAACTCAATCACAAAAATATTGTCAAATTATTTGCTATTGAAGAGGAGACAACAACAAGACATAAAGTACTTATTATGGAATTTTGTCCATGTGGGAGTTTATACACTGTTTTAGAAGAACCTTCTAATGCCTATGGACTACCAGAATCTGAATTCTTAATTGTTTTGCGAGATGTGGTGGGTGGAATGAAT

Numéro d'accès Ensembl | humain

ENSG00000183735

Numéro d'accès NCBI

NM_013254

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... TBK1(29110) , TBK1(29110)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
ADV
JUU
QCS
KBU
IYT

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yanyu Zhang et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(7), 7822-7832 (2019-03-27)
Platelets can promote several stages of the metastatic process and thus contribute to malignant progression. As an example, platelets promote invasive properties of tumor cells by induction of epithelial to mesenchymal transition (EMT). In this study, we show that tumor
Kaixuan Cui et al.
Biochemical and biophysical research communications, 503(1), 202-208 (2018-06-05)
choroidal neovascularization (CNV), a characteristic of wet age-related macular degeneration (AMD), causes severe vision loss among elderly patients. TANK-binding kinase 1 (TBK1) is a ubiquitously expressed serine-threonine kinase and is found to induce endothelial cells proliferation, represent a novel mediator
Chaping Cheng et al.
Theranostics, 8(17), 4633-4648 (2018-10-04)
Tumor metastasis is the major cause of death for prostate cancer (PCa) patients. However, the treatment options for metastatic PCa are very limited. Epithelial-mesenchymal transition (EMT) has been reported to be an indispensable step for tumor metastasis and is suggested
Ha Linh Vu et al.
Molecular cancer research : MCR, 12(10), 1509-1519 (2014-06-26)
Melanoma is a devastating form of skin cancer with limited therapeutic options. Fifteen to 20% of patients with melanoma have an activating mutation in the GTPase, NRAS. The major downstream effectors of RAS are RAFs (ARAF, BRAF, and CRAF), phosphoinositide
Petra Mlcochova et al.
Cell reports, 30(12), 3972-3980 (2020-03-27)
Macrophages exist predominantly in two distinct states, G0 and a G1-like state that is accompanied by phosphorylation of SAMHD1 at T592. Here, we demonstrate that Toll-like receptor 4 (TLR4) activation can potently induce G0 arrest and SAMHD1 antiretroviral activity by
Afficher tous les articles scientifiques apparentés

Questions

Évaluations

Aucune valeur de notation

Filtres actifs

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique