Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU033791

Sigma-Aldrich

MISSION® esiRNA

targeting human MIB1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGATTGCAGATTGGTGACCTGGTAAATATAGATCTCGACCTCGAAATTGTACAGTCTTTGCAGCATGGTCATGGAGGATGGACTGATGGAATGTTTGAGACTTTAACTACAACTGGAACTGTTTGTGGCATTGATGAAGATCATGACATTGTAGTACAGTATCCAAGTGGCAATAGGTGGACCTTCAATCCTGCTGTTCTCACTAAAGCGAACATTGTCCGAAGTGGAGATGCTGCTCAGGGTGCAGAAGGAGGCACCTCGCAGTTTCAAGTGGGTGATCTTGTACAAGTTTGTTATGACCTGGAACGAATTAAACTTCTACAAAGAGGACATGGAGAATGGGCTGAAGCGATGCTTCCAACTTTAGGTAAAGTTGGCCGAGTACAACAGATTTATTCAGACAGTGATTTAAAGGTGGAAGTTTGTGGAACATCTTGGACATACAATCCAGCAGCAGTTTCCAAGGTGGCATCT

Numéro d'accès Ensembl | humain

ENSG00000101752

Numéro d'accès NCBI

NM_020774

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... MIB1(57534) , MIB1(57534)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yoshihiro Otani et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 26(10), 2381-2392 (2020-03-07)
To examine the effect of oncolytic herpes simplex virus (oHSV) on NOTCH signaling in central nervous system tumors. Bioluminescence imaging, reverse phase protein array proteomics, fluorescence microscopy, reporter assays, and molecular biology approaches were used to evaluate NOTCH signaling. Orthotopic
Osamu Nakabayashi et al.
Communications biology, 4(1), 80-80 (2021-01-21)
Mind bomb 2 (MIB2) is an E3 ligase involved in Notch signalling and attenuates TNF-induced apoptosis through ubiquitylation of receptor-interacting protein kinase 1 (RIPK1) and cylindromatosis. Here we show that MIB2 bound and conjugated K48- and K63-linked polyubiquitin chains to
Marissa A Scavuzzo et al.
Cell reports, 25(13), 3811-3827 (2018-12-28)
Notch is activated globally in pancreatic progenitors; however, for progenitors to differentiate into endocrine cells, they must escape Notch activation to express Neurogenin-3. Here, we find that the transcription factor nuclear factor I/A (NFIA) promotes endocrine development by regulating Notch

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique