Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU029441

Sigma-Aldrich

MISSION® esiRNA

targeting human MEX3C

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CATATTGCCATGCGTACAGGAAACTATATAGAGCTCAATGAAGAGAATGATTTCCATTACAATGGTACCGATGTAAGCTTTGAAGGTGGCACTCTTGGCTCTGCGTGGCTCTCCTCCAATCCTGTTCCTCCTAGCCGCGCAAGAATGATATCCAATTATCGAAATGATAGTTCCAGTTCTCTAGGAAGTGGCTCTACAGATTCCTACTTTGGAAGCAATAGGCTGGCTGACTTTAGTCCAACAAGCCCATTTAGCACAGGAAACTTCTGGTTTGGAGATACACTACCATCTGTAGGCTCAGAAGACCTAGCAGTTGACTCTCCTGCCTTTGACTCTTTACCAACATCTGCTCAAACTATCTGGACTCCATTTGAACCAGTTAACCCACTCTCTGGCTTTGGGAGTGATCCTTCTGG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Qingsong Hu et al.
Cell research, 29(4), 286-304 (2019-01-12)
Despite the structural conservation of PTEN with dual-specificity phosphatases, there have been no reports regarding the regulatory mechanisms that underlie this potential dual-phosphatase activity. Here, we report that K27-linked polyubiquitination of PTEN at lysines 66 and 80 switches its phosphoinositide/protein
Pin Lu et al.
PloS one, 12(10), e0185992-e0185992 (2017-10-06)
Some RNA species, especially microRNAs, are non-randomly sorted into exosomes, but how selectivity of RNA exosomal sorting is achieved is unknown. We found that all three variants of RNA-binding ubiquitin E3 ligase (MEX3C)-MEX3C-1, MEX3C-2, and MEX3C-3 -interact with adaptor-related protein
Yajuan Li et al.
The Journal of clinical investigation, 129(3), 1129-1151 (2019-02-12)
Epithelial-mesenchymal transition (EMT) contributes significantly to interstitial matrix deposition in diabetic kidney disease (DKD). However, detection of EMT in kidney tissue is impracticable, and anti-EMT therapies have long been hindered. We reported that phosphatase and tensin homolog (PTEN) promoted transforming

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique