Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU027151

Sigma-Aldrich

MISSION® esiRNA

targeting human CHRM3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCTCCTCCTGGATACACAGCCCCTCCGATGCAGGGCTGCCCCCGGGAACCGTCACTCATTTCGGCAGCTACAATGTTTCTCGAGCAGCTGGCAATTTCTCCTCTCCAGACGGTACCACCGATGACCCTCTGGGAGGTCATACCGTCTGGCAAGTGGTCTTCATCGCTTTCTTAACGGGCATCCTGGCCTTGGTGACCATCATCGGCAACATCCTGGTAATTGTGTCATTTAAGGTCAACAAGCAGCTGAAGACGGTCAACAACTACTTCCTCTTAAGCCTGGCCTGTGCCGATCTGATTATCGGGGTCATTTCAATGAATCTGTTTACGACCTACATCATCATGAATCGATGGGCCTTAGGGAACTTGGCCTGTGACCTCTGGCTTGCCATTGACTACGTAGCCAGCAATGCCTCTGT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Zhenhua Shang et al.
Neurourology and urodynamics, 38(2), 615-624 (2018-12-15)
To investigate the effects of injecting RNA interference (RNAi) lentiviruses targeting the muscarinic 3 (M3 ) receptor gene into the bladder wall on bladder activity in rats with spinal cord injury (SCI). Four M3 RNAi lentiviruses were constructed and used
Mahmoud Mona et al.
International journal of molecular sciences, 20(3) (2019-02-15)
Sjögren's syndrome (SjS) is an autoimmune disease that destroys the salivary glands and results in severe dry mouth. Mesenchymal stem cell (MSC) transplantation has been recently proposed as a promising therapy for restoring cells in multiple degenerative diseases. We have
Lulu Farhana et al.
Stem cell research & therapy, 7(1), 181-181 (2016-12-03)
Although the unconjugated secondary bile acids, specifically deoxycholic acid (DCA) and lithocholic acid (LCA), are considered to be risk factors for colorectal cancer, the precise mechanism(s) by which they regulate carcinogenesis is poorly understood. We hypothesize that the cytotoxic bile
Huangfei Yu et al.
Scientific reports, 7, 40802-40802 (2017-01-20)
Acetylcholine (ACh), known as a neurotransmitter, regulates the functions of numerous fundamental central and peripheral nervous system. Recently, emerging evidences indicate that ACh also plays an important role in tumorigenesis. However, little is known about the role of ACh in
Fenglin Sun et al.
Phytotherapy research : PTR, 33(5), 1551-1561 (2019-05-09)
Aacacetin, a plant flavone has shown antitumor efficacy recently. However, its associated mechanisms are poorly known. We hypothesized that the muscarinic M3 receptor (M3 R), which is highly expressed in some cancer tissue, is related to the antitumor effect of

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique