Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU026851

Sigma-Aldrich

MISSION® esiRNA

targeting human TBC1D9

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTGGTGGACCAAGGTGTCTTTGAGGAGCTAGCACGAGACTACGTCCCACAGCTGTACGACTGCATGCAAGACCTGGGCGTGATTTCCACCATCTCCCTGTCTTGGTTCCTCACACTATTTCTCAGTGTGATGCCTTTTGAGAGTGCAGTTGTGGTTGTTGACTGTTTCTTCTATGAAGGAATTAAAGTGATATTCCAGTTGGCCCTAGCTGTGCTGGATGCAAATGTGGACAAACTGTTGAACTGCAAGGATGATGGGGAGGCCATGACCGTTTTGGGAAGGTATTTAGACAGTGTGACCAATAAAGACAGCACACTGCCTCCCATTCCTCACCTCCACTCCTTGCTCAGCGATGATGTGGAACCTTACCCTGAGGTAGACATCTTTAGACTCATCAGAACTTCCTACGAGAAATTCGGAACTATCCGGGCAGATTTGATTGAACAGATGAGATTCAAACAGAGACTGAAAGTGATCCAGACGCTG

Numéro d'accès Ensembl | humain

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Tao Wang et al.
Theranostics, 5(12), 1456-1472 (2015-12-19)
Understanding the molecular basis of drug resistance and utilising this information to overcome chemoresistance remains a key challenge in oncology. Here we report that survivin, a key protein implicated in drug resistance, is overexpressed in cancer stem cell pool of
Xiaoqian Yang et al.
Pharmaceutical research, 32(6), 2097-2109 (2014-12-18)
Approaches for the synthesis of biomaterials to facilitate the delivery of "biologics" is a major area of research in cancer therapy. Here we designed and characterized a hyaluronic acid (HA) based self-assembling nanoparticles that can target CD44 receptors overexpressed on
Runbi Ji et al.
Cell cycle (Georgetown, Tex.), 14(15), 2473-2483 (2015-06-20)
Mesenchymal stem cells (MSCs) play an important role in chemoresistance. Exosomes have been reported to modify cellular phenotype and function by mediating cell-cell communication. In this study, we aimed to investigate whether exosomes derived from MSCs (MSC-exosomes) are involved in
Takashi Nozawa et al.
Nature communications, 11(1), 770-770 (2020-02-09)
Invading microbial pathogens can be eliminated selectively by xenophagy. Ubiquitin-mediated autophagy receptors are phosphorylated by TANK-binding kinase 1 (TBK1) and recruited to ubiquitinated bacteria to facilitate autophagosome formation during xenophagy, but the molecular mechanism underlying TBK1 activation in response to
Xia Wen et al.
Toxicological sciences : an official journal of the Society of Toxicology, 141(2), 475-483 (2014-07-13)
Paraquat is a herbicide that is highly toxic to the lungs and kidneys following acute exposures. Prior studies have demonstrated that the organic cation transporter 2 and multidrug and toxin extrusion protein 1 contribute to the urinary secretion of paraquat

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique