Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU025941

Sigma-Aldrich

MISSION® esiRNA

targeting human EIF4A3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCAGTGGAGAGGGAAGAGTGGAAATTTGACACTCTGTGTGACCTCTACGACACACTGACCATCACTCAGGCGGTCATCTTCTGCAACACCAAAAGAAAGGTGGACTGGCTGACGGAGAAAATGAGGGAAGCCAACTTCACTGTATCCTCAATGCATGGAGACATGCCCCAGAAAGAGCGGGAGTCCATCATGAAGGAGTTCCGGTCGGGCGCCAGCCGAGTGCTTATTTCTACAGATGTCTGGGCCAGGGGGTTGGATGTCCCTCAGGTGTCCCTCATCATTAACTATGATCTCCCTAATAACAGAGAATTGTACATACACAGAATTGGGAGATCAGGTCGATACGGCCGGAAGGGTGTGGCCATTAACTTTGTAAAGAATGACGACATCCGCATCCTCAGAGATATCGAGCAGTACTATTCCACTCAGATTGATGAGATGCCGATGAACGTTGCTGATCTTATCTGAAGCAGCAGATCAGTGGGAT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Lei Wang et al.
Aging, 12(21), 21674-21686 (2020-11-12)
Bladder cancer (BC) is one of the most commonly diagnosed urologic carcinomas, with high recurrence and death rates. Circular RNAs (circRNAs) are a class of noncoding RNAs which are anomalously expressed in cancers and involved in the progression of cancers.
Hang Song et al.
Clinical and translational medicine, 10(7), e220-e220 (2020-12-01)
Growing evidences have been revealing that long noncoding RNAs are vital factors in oncogenesis and tumor development. Among them, cancer susceptibility candidate 11 (CASC11) has displayed an impressively essential role in various kinds of cancers including hepatocellular carcinoma (HCC). Nevertheless

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique