Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU025551

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC9A1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CACCACTGGAACTGGACCTTCGTCATCAGCACCCTGCTCTTCTGCCTCATCGCCCGCGTGCTGGGGGTGCTGGGCCTGACCTGGTTCATCAACAAGTTCCGTATCGTGAAGCTGACCCCCAAGGACCAGTTCATCATCGCCTATGGGGGCCTGCGAGGGGCCATCGCCTTCTCTCTGGGCTACCTCCTGGACAAGAAGCACTTCCCCATGTGTGACCTGTTCCTCACTGCCATCATCACTGTCATCTTCTTCACCGTCTTTGTGCAGGGCATGACCATTCGGCCCCTGGTAGACCTGTTGGCTGTGAAGAAAAAGCAAGAGACGAAGCGCTCCATCAACGAAGAGATCCACACACAGTTCCTGGACCACCTTCTGACAGGCATCGAAGACATCTGTGGCCACTACGGTCACCACCACTG

Numéro d'accès Ensembl | humain

ENSG00000090020

Numéro d'accès NCBI

NM_003047

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... SLC9A1(6548) , SLC9A1(6548)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yosuke Ariyoshi et al.
Oncotarget, 8(2), 2209-2223 (2016-12-03)
Na+/H+ exchanger 1 (NHE1) is a plasma membrane transporter that controls intracellular pH and regulates apoptosis and invasion in various cancer cells. However, the function of NHE1 in esophageal squamous cell carcinoma (ESCC) cells and the relationship between the expression
A K Pedersen et al.
BMC cancer, 17(1), 542-542 (2017-08-16)
Chronic angiogenesis is a hallmark of most tumors and takes place in a hostile tumor microenvironment (TME) characterized by hypoxia, low nutrient and glucose levels, elevated lactate and low pH. Despite this, most studies addressing angiogenic signaling use hypoxia as
Yogesh Singh et al.
The Journal of biological chemistry, 291(45), 23662-23671 (2016-09-16)
CD4
Zhenni Sun et al.
OncoTargets and therapy, 13, 8521-8532 (2020-09-10)
Several recent studies have addressed the role of Na+/H+ exchanger isoform 1 (NHE1) in tumor cell growth and apoptosis, including in gastric cancer. However, the role of NHE1 expression related to the 5-Fu resistance in gastric cancer has not been
Raj R Malinda et al.
Frontiers in oncology, 10, 687-687 (2020-05-28)
Pancreatic ductal adenocarcinoma (PDAC) is a major cause of cancer-related death, with a 5-year survival of <10% and severely limited treatment options. PDAC hallmarks include profound metabolic acid production and aggressive local proliferation and invasiveness. This phenotype is supported by
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique