Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU016751

Sigma-Aldrich

MISSION® esiRNA

targeting human CTGF

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme

Sélectionner une taille de conditionnement

20 μG
195,00 €
50 μG
345,00 €

195,00 €


Date d'expédition estimée le17 mai 2025



Sélectionner une taille de conditionnement

Changer de vue
20 μG
195,00 €
50 μG
345,00 €

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

195,00 €


Date d'expédition estimée le17 mai 2025


Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTGCACCAGCATGAAGACATACCGAGCTAAATTCTGTGGAGTATGTACCGACGGCCGATGCTGCACCCCCCACAGAACCACCACCCTGCCGGTGGAGTTCAAGTGCCCTGACGGCGAGGTCATGAAGAAGAACATGATGTTCATCAAGACCTGTGCCTGCCATTACAACTGTCCCGGAGACAATGACATCTTTGAATCGCTGTACTACAGGAAGATGTACGGAGACATGGCATGAAGCCAGAGAGTGAGAGACATTAACTCATTAGACTGGAACTTGAACTGATTCACATCTCATTTTTCCGTAAAAATGATTTCAGTAGCACAAGTTATTTAAATCTGTTTTTCTAACTGGGGGAAAAGATTCCCACCCAATTCAAAACATTGTGCCATGTCAAACAAATAGTCTATCAACCCCAGACACTGGTTTGAAGAATGTTAAGACTTGACAGTGGAACTACATTAGTACACAGCACCAGAATGTATATTAAGGTGTGGCTTTAGGAGCA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Erika Gucciardo et al.
International journal of molecular sciences, 19(12) (2018-12-16)
Diabetic retinopathy (DR) is the most common diabetic microvascular complication and major cause of blindness in working-age adults. According to the level of microvascular degeneration and ischemic damage, DR is classified into non-proliferative DR (NPDR), and end-stage, proliferative DR (PDR).
Arunachal Chatterjee et al.
PloS one, 12(12), e0190217-e0190217 (2017-12-30)
Perspectives on whether the functions of MAS, a G protein-coupled receptor, are beneficial or deleterious in the heart remain controversial. MAS gene knockout reduces coronary vasodilatation leading to ischemic injury. G protein signaling activated by MAS has been implicated in
Kai Yang et al.
OncoTargets and therapy, 9, 7285-7295 (2016-12-13)
Colorectal cancer (CRC) is one of the most commonly diagnosed cancers among both males and females; the chemotherapy drug 5-fluorouracil (5-FU) is one of a doctors' first lines of defense against CRC. However, therapeutic failures are common because of the
Jung-Chien Cheng et al.
Oncotarget, 8(49), 85224-85233 (2017-11-22)
Ovarian low-grade serous carcinoma (LGSC) is a rare disease and is now considered to be a distinct entity from high-grade serous carcinoma (HGSC), which is the most common and malignant form of epithelial ovarian cancer. Connective tissue growth factor (CTGF)
Hiroshi Kinashi et al.
Scientific reports, 9(1), 12175-12175 (2019-08-23)
Lymphatic absorption in the peritoneal cavity may contribute to ultrafiltration failure in peritoneal dialysis (PD). Lymphatic vessels develop during PD-related peritoneal fibrosis. Connective tissue growth factor (CTGF, also called CCN2) is an important determinant of fibrotic tissue remodeling, but little

Questions

Évaluations

Aucune valeur de notation

Filtres actifs

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique