Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU016411

Sigma-Aldrich

MISSION® esiRNA

targeting human MAPKAPK5 (2)

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCTGGGAGCTGGAATTAGTGGTCCAGTTAGAGTCTGTGTAAAGAAATCTACTCAAGAACGGTTTGCGCTGAAAATTCTTCTTGATCGTCCAAAAGCTAGAAATGAGGTACGTCTGCACATGATGTGTGCCACACACCCAAACATAGTTCAGATTATTGAAGTGTTTGCTAACAGTGTCCAGTTTCCCCATGAGTCCAGCCCTAGGGCCCGACTCTTAATTGTAATGGAGATGATGGAAGGGGGAGAGCTATTTCACAGAATCAGCCAGCACCGGCACTTTACAGAGAAGCAAGCCAGCCAAGTAACAAAGCAGGCAACTTTGGCTCTGCGGCACTGTCACTTGTTAAACATTGCGCACAGAGACCTCAAGCCTGAAAATCTGCTTTTTAAGGATAACTCTTTGGATGCCCCAGTGAAGTTGTGTGACTTTGGATTTGCCAAGATTGACCAAGGTGACTTGATGACACCCCAGTTCACCCCTTATTATGTAGCACCCCAGGTACTGGA

Numéro d'accès Ensembl | humain

ENSG00000089022

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... MAPKAPK5(8550) , MAPKAPK5(8550)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Sherin Ali Nawaito et al.
American journal of physiology. Heart and circulatory physiology, 316(6), H1281-H1296 (2019-03-23)
MK5 is a protein serine/threonine kinase activated by p38, ERK3, and ERK4 MAPKs. MK5 mRNA and immunoreactivity are detected in mouse cardiac fibroblasts, and MK5 haplodeficiency attenuates the increase in collagen 1-α1 mRNA evoked by pressure overload. The present study
Natalia Ronkina et al.
PloS one, 10(8), e0136138-e0136138 (2015-08-22)
MK5 (MAPK-activated protein kinase 5) or PRAK (p38-regulated and -activated kinase) are alternative names for a serine/threonine protein kinase downstream to ERK3/4 and p38 MAPK. A previous gene targeting approach for MK5/PRAK (termed here MK5/PRAK-Δex8) revealed a seemingly tumor-suppressive role
Yoonhee Kim et al.
Molecular neurodegeneration, 11, 4-4 (2016-01-14)
The receptor for advanced glycation end products (RAGE) has been found to interact with amyloid β (Aβ). Although RAGE does not have any kinase motifs in its cytosolic domain, the interaction between RAGE and Aβ triggers multiple cellular signaling involved
Katarzyna Bogucka et al.
eLife, 9 (2020-04-22)
ERK3 is a ubiquitously expressed member of the atypical mitogen activated protein kinases (MAPKs) and the physiological significance of its short half-life remains unclear. By employing gastrointestinal 3D organoids, we detect that ERK3 protein levels steadily decrease during epithelial differentiation.

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique