Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU016271

Sigma-Aldrich

MISSION® esiRNA

targeting human JAM3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme

Sélectionner une taille de conditionnement

20 μG
195,00 €
50 μG
345,00 €

195,00 €


Check Cart for Availability


Sélectionner une taille de conditionnement

Changer de vue
20 μG
195,00 €
50 μG
345,00 €

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

195,00 €


Check Cart for Availability

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AAATGACCGCAAGGAAATTGATGAGATTGTGATCGAGTTAACTGTGCAAGTGAAGCCAGTGACCCCTGTCTGTAGAGTGCCGAAGGCTGTACCAGTAGGCAAGATGGCAACACTGCACTGCCAGGAGAGTGAGGGCCACCCCCGGCCTCACTACAGCTGGTATCGCAATGATGTACCACTGCCCACGGATTCCAGAGCCAATCCCAGATTTCGCAATTCTTCTTTCCACTTAAACTCTGAAACAGGCACTTTGGTGTTCACTGCTGTTCACAAGGACGACTCTGGGCAGTACTACTGCATTGCTTCCAATGACGCAGGCTCAGCCAGGTGTGAGGAGCAGGAGATGGAAGTCTATGACCTGAACATTGGCGGAATTATTGGGGGGGTTCTGGTTGTCCTTGCTGTACTGGCCCTGATCACGTTGGGCATCTGCTGTGCATACAGACGTGGCTACTTCATCAACAATAAACAGGATGGAGAAAGTTACAAGAACCCAGGGAAACCAGAT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

Si vous avez besoin d'assistance, veuillez contacter Service Clients

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Xudong Li et al.
International journal of molecular medicine, 42(5), 2923-2929 (2018-09-19)
As a common type of renal cancer, renal cell carcinoma (RCC) has a high annual mortality rate. The incidence of RCC has been increasing in China and worldwide. A large number cases of RCC are diagnosed at late stages, often
SongNan Hao et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 35(6), 5675-5687 (2014-03-04)
This study aims to investigate lymphatic metastasis-related genes in non-small cell lung carcinomas (NSCLC). NSCLC tissue was analyzed for expression of junctional adhesion molecule-C (JAM-C) protein. Our data revealed novel associations between JAM-C overexpression in primary tumors and lymphatic microvessel
Matina Economopoulou et al.
Thrombosis and haemostasis, 114(6), 1241-1249 (2015-08-28)
In proliferative retinopathies, like proliferative diabetic retinopathy and retinopathy of prematurity (ROP), the hypoxia response is sustained by the failure of the retina to revascularise its ischaemic areas. Non-resolving retina ischaemia/hypoxia results in upregulation of pro-angiogenic factors and pathologic neovascularisation

Questions

Évaluations

Aucune valeur de notation

Filtres actifs

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique