Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

Voir toute la documentation

EHU015991

Sigma-Aldrich

MISSION® esiRNA

targeting human SSRP1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCCAAACTCGCTACCACTTCCTGATCCTCCTCTTCTCCAAGGACGAGGACATTTCGTTGACTCTGAACATGAACGAGGAAGAAGTGGAGAAGCGCTTTGAGGGTCGGCTCACCAAGAACATGTCAGGATCCCTCTATGAGATGGTCAGCCGGGTCATGAAAGCACTGGTAAACCGCAAGATCACAGTGCCAGGCAACTTCCAAGGGCACTCAGGGGCCCAGTGCATTACCTGTTCCTACAAGGCAAGCTCAGGACTGCTCTACCCGCTGGAGCGGGGCTTCATCTACGTCCACAAGCCACCTGTGCACATCCGCTTCGATGAGATCTCCTTTGTCAACTTTGCTCGTGGTACCACTACTACTCGTTCCTTTGACTTTGAAATTGAGACCAAGCAGGGCACTCAGTATACCTTCAGCAGCATTGAGAGGGAGGAGTACGGGAAACTGTTTGATTTTGTCAACGCGAAAAAGCTCAACATCAAAAACCGAGGATTGAAAGAGGGCATGAA

Numéro d'accès Ensembl | humain

ENSG00000149136

Numéro d'accès NCBI

NM_003146

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... SSRP1(6749) , SSRP1(6749)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
YDV
FAV
RXU
SWU
BWU

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Wenyong Long et al.
Journal of molecular cell biology, 10(2), 147-160 (2018-02-17)
The differentiation status of neuroblastoma (NB) strongly correlates with its clinical outcomes; however, the molecular mechanisms driving maintenance of stemness and differentiation remain poorly understood. Here, we show that plant homeodomain finger-containing protein 20 (PHF20) functions as a critical epigenetic
Alan S Wang et al.
Molecular cell, 79(2), 221-233 (2020-07-01)
Cas9 is a prokaryotic RNA-guided DNA endonuclease that binds substrates tightly in vitro but turns over rapidly when used to manipulate genomes in eukaryotic cells. Little is known about the factors responsible for dislodging Cas9 or how they influence genome engineering.
Ling Bi et al.
International journal of cancer, 145(1), 164-178 (2018-12-15)
Cancer cell repopulation through cell cycle re-entry by quiescent (G0 ) cell is thought to be an important mechanism behind treatment failure and cancer recurrence. Facilitates Chromatin Transcription (FACT) is involved in DNA repair, replication and transcription by eviction of
Miranda M Tallman et al.
Cancer letters, 499, 232-242 (2020-12-01)
Glioblastoma (GBM) is an incurable brain tumor with inevitable recurrence. This is in part due to a highly malignant cancer stem cell (CSC) subpopulation of tumor cells that is particularly resistant to conventional treatments, including radiotherapy. Here we show that
Ying Gao et al.
Cancer research, 77(10), 2674-2685 (2017-04-19)
DNA single-strand breaks (SSB) are the most common form of DNA damage, requiring repair processes that to initiate must overcome chromatin barriers. The FACT complex comprised of the SSRP1 and SPT16 proteins is important for maintaining chromatin integrity, with SSRP1

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique