Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

Voir toute la documentation

EHU011701

Sigma-Aldrich

MISSION® esiRNA

targeting human CARTPT

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ACGAGAAGGAGCTGATCGAAGCGCTGCAAGAAGTCTTGAAGAAGCTCAAGAGTAAACGTGTTCCCATCTATGAGAAGAAGTATGGCCAAGTCCCCATGTGTGACGCCGGTGAGCAGTGTGCAGTGAGGAAAGGGGCAAGGATCGGGAAGCTGTGTGACTGTCCCCGAGGAACCTCCTGCAATTCCTTCCTCCTGAAGTGCTTATGAAGGGGCGTCCATTCTCCTCCATACATCCCCATCCCTCTACTTTCCCCAGAGGACCACACCTTCCTCCCTGGAGTTTGGCTTAAGCAACAGATAAAGTTTTTATTTTCCTCTGAAGGGAAAGGGCTCTTTTCCTGCTGTTTCAAAAATAAAAGAACACATTAGATGTTACTGTGTGAAGAATAATGCCTTGTATGGTGTTGATACGTGTGTGAAGTATTCTTATTTTATTTGTCTGACAAACTCTTGTGTACCTTTGTGTAAAGAAGGGAAGCTTTGTTTGAAAATTGTATTTTTGTATGTGGCATGGCAGAAT

Numéro d'accès Ensembl | humain

ENSG00000164326

Numéro d'accès NCBI

NM_004291

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... CARTPT(9607) , CARTPT(9607)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

L Shcherbina et al.
Molecular and cellular endocrinology, 447, 52-60 (2017-02-27)
Impaired beta-cell function is key to the development of type 2 diabetes. Cocaine- and amphetamine-regulated transcript (CART) is an islet peptide with insulinotropic and glucagonostatic properties. Here we studied the role of endogenous CART in beta-cell function. CART silencing in
Ji-Yao Li et al.
Journal of neurophysiology, 121(3), 928-939 (2019-01-17)
Hyperphagia is common in diabetes and may worsen hyperglycemia and diabetic complications. The responsible mechanisms are not well understood. The hypothalamus is a key center for the control of appetite and energy homeostasis. The ventromedial nucleus (VMH) and arcuate nucleus
Shin J Lee et al.
Cell reports, 30(6), 2028-2039 (2020-02-13)
The vagus nerve conveys gastrointestinal cues to the brain to control eating behavior. In obesity, vagally mediated gut-brain signaling is disrupted. Here, we show that the cocaine- and amphetamine-regulated transcript (CART) is a neuropeptide synthesized proportional to the food consumed

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique