Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU010511

Sigma-Aldrich

MISSION® esiRNA

targeting human VANGL2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCAGGAAGAGGAGCAGAAAAACCCCAGGGAGGTGATGGACCCCCGGGAGGCAGCCCAAGCCATCTTTGCATCCATGGCCCGTGCCATGCAGAAGTACCTTCGGACCACCAAGCAGCAGCCCTACCACACCATGGAGAGCATCCTGCAGCACCTTGAATTCTGCATCACGCATGACATGACGCCCAAGGCCTTCTTGGAGCGATACTTGGCGGCTGGACCTACCATCCAGTACCACAAGGAACGCTGGCTGGCCAAACAGTGGACATTGGTGAGCGAGGAGCCGGTGACCAACGGCCTCAAGGATGGCATCGTTTTCCTCTTAAAACGCCAGGACTTCAGCCTGGTGGTCAGCACCAAGAAGGTCCCATTCTTCAAACTCTCCGAGGAATTTGTGGATCCCAAGTCACACAAGTTTGTCATGAGGCTGCAGTC

Numéro d'accès Ensembl | humain

ENSG00000162738

Numéro d'accès NCBI

NM_020335

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... VANGL2(57216) , VANGL2(57216)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Zhaoming Wu et al.
Cell and tissue research, 366(3), 617-621 (2016-09-04)
Vangl2, one of the core components of the planar cell polarity (PCP) pathway, has an important role in the regulation of morphogenesis in several tissues. Although the expression of Vangl2 has been detected in the developing tooth, its role in
Tania M Puvirajesinghe et al.
Nature communications, 7, 10318-10318 (2016-01-13)
The non-canonical Wnt/planar cell polarity (Wnt/PCP) pathway plays a crucial role in embryonic development. Recent work has linked defects of this pathway to breast cancer aggressiveness and proposed Wnt/PCP signalling as a therapeutic target. Here we show that the archetypal
Sek-Shir Cheong et al.
Frontiers in cell and developmental biology, 8, 577201-577201 (2020-11-17)
VANGL2 is a component of the planar cell polarity (PCP) pathway, which regulates tissue polarity and patterning. The Vangl2 Lp mutation causes lung branching defects due to dysfunctional actomyosin-driven morphogenesis. Since the actomyosin network regulates cell mechanics, we speculated that

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique