Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU010441

Sigma-Aldrich

MISSION® esiRNA

targeting human VDR

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCAGTTCGTGTGAATGATGGTGGAGGGAGCCATCCTTCCAGGCCCAACTCCAGACACACTCCCAGCTTCTCTGGGGACTCCTCCTCCTCCTGCTCAGATCACTGTATCACCTCTTCAGACATGATGGACTCGTCCAGCTTCTCCAATCTGGATCTGAGTGAAGAAGATTCAGATGACCCTTCTGTGACCCTAGAGCTGTCCCAGCTCTCCATGCTGCCCCACCTGGCTGACCTGGTCAGTTACAGCATCCAAAAGGTCATTGGCTTTGCTAAGATGATACCAGGATTCAGAGACCTCACCTCTGAGGACCAGATCGTACTGCTGAAGTCAAGTGCCATTGAGGTCATCATGTTGCGCTCCAATGAGTCCTTCACCATGGACGACATGTCCTGGACCTGTGGCAACCAAGACTACAAGTACCGCGTCAGTGACGTGACCAAAGCCGGACACAGCCTGGAGCTGATTGAGCCCCTCATCAAGTTCCAGGTGGGACTGAAGAAGCTGAACTTGCATGAGGAGGAGC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yang Gao et al.
International journal of molecular medicine, 46(4), 1538-1550 (2020-09-19)
Psoriasis is an immune‑mediated dermatosis characterized by T‑lymphocyte‑mediated epidermal hyperplasia, for which there are currently no effective clinical treatments. 'Psoriasis 1' is a Chinese herbal medicine formulation that has been recently used extensively in China for treating patients with psoriasis. However
Ken-ichiro Tanaka et al.
Biochemical and biophysical research communications, 450(1), 482-487 (2014-06-14)
Vitamin D deficiency and advanced glycation end products (AGEs) are suggested to be involved in the pathogenesis of osteoporosis and sarcopenia. However, the effects of vitamin D and AGEs on myogenesis and the interaction between muscle and bone remains still
Lars Brodowski et al.
PloS one, 9(6), e98527-e98527 (2014-06-03)
Placenta-derived circulating factors contribute to the maternal endothelial dysfunction underlying preeclampsia. Endothelial colony forming cells (ECFC), a sub-population of endothelial progenitor cells (EPCs), are thought to be involved in vasculogenesis and endothelial repair. Low vitamin D concentrations are associated with
Aurélien Mary et al.
Endocrinology, 156(6), 1965-1974 (2015-03-13)
Vascular calcification (VC) is a degenerative disease that contributes to cardiovascular morbidity and mortality. A negative relationship has been demonstrated between VC and calcium sensing receptor (CaSR) expression in the vasculature. Of interest, vitamin D response elements, which allow responsiveness
T P H Nguyen et al.
Journal of molecular medicine (Berlin, Germany), 93(7), 795-805 (2015-02-27)
Fetal growth restriction (FGR) affects up to 5 % of pregnancies worldwide, and trophoblast function plays a significant role on the outcome. An epidemiological study has linked vitamin D deficiency to adverse perinatal outcomes, which include decreased birth weight. The

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique