Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

Voir toute la documentation

EHU009271

Sigma-Aldrich

MISSION® esiRNA

targeting human PPM1D

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TTGTCAGAGCTGTGGAGGTGACACAGGACCATAAGCCAGAACTTCCCAAGGAAAGAGAACGAATCGAAGGACTTGGTGGGAGTGTAATGAACAAGTCTGGGGTGAATCGTGTAGTTTGGAAACGACCTCGACTCACTCACAATGGACCTGTTAGAAGGAGCACAGTTATTGACCAGATTCCTTTTCTGGCAGTAGCAAGAGCACTTGGTGATTTGTGGAGCTATGATTTCTTCAGTGGTGAATTTGTGGTGTCACCTGAACCAGACACAAGTGTCCACACTCTTGACCCTCAGAAGCACAAGTATATTATATTGGGGAGTGATGGACTTTGGAATATGATTCCACCACAAGATGCCATCTCAATGTGCCAGGACCAAGAGGAGAAAAAATACCTGATGGGTGAGCATGGACAATCTTGTGCCAAAATGCTTGTG

Numéro d'accès Ensembl | humain

ENSG00000170836

Numéro d'accès NCBI

NM_003620

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... PPM1D(8493) , PPM1D(8493)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Chen Chen et al.
Journal of Cancer, 11(11), 3216-3224 (2020-04-02)
Accumulated studies showed that numerous microRNAs (miRNAs) were aberrantly expressed in human intrahepatic cholangiocarcinoma (ICC) and contributed to the tumorigenic processes. However, whether miR-129-2-3p is implicated in the ICC initiation and progression is still limited. Here, the results revealed that
Zhong-Wu Lu et al.
Oncology reports, 43(3), 783-794 (2020-01-11)
Endeavors towards identifying key molecular markers for early diagnosis and treatment are driving the clinical study of papillary thyroid carcinoma (PTC). Recent studies have indicated that protein phosphatase, Mg2+/Mn2+ dependent, 1D (PPM1D) exerts an oncogenic function by increasing cell proliferation, migration
Dong-Seok Park et al.
EMBO reports, 21(5), e48693-e48693 (2020-02-28)
The tumor suppressor Smad4, a key mediator of the TGF-β/BMP pathways, is essential for development and tissue homeostasis. Phosphorylation of Smad4 in its linker region catalyzed by the mitogen-activated protein kinase (MAPK) plays a pivotal role in regulating its transcriptional
Shigeo Ohba et al.
Cell reports, 31(2), 107518-107518 (2020-04-16)
The metabolic enzyme phosphoglycerate mutase 1 (PGAM1) is overexpressed in several types of cancer, suggesting an additional function beyond its established role in the glycolytic pathway. We here report that PGAM1 is overexpressed in gliomas where it increases the efficiency
Jin Ju Park et al.
Technology in cancer research & treatment, 19, 1533033820964425-1533033820964425 (2020-10-24)
Several techniques have been employed for deletion of the NKX3.1 gene, resulting in developmental defects of the prostate, including alterations in ductal branching morphogenesis and prostatic secretions as well as epithelial hyperplasia and dysplasia. To investigate whether the CRISPR/Cas9-mediated technique
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique