Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU008491

Sigma-Aldrich

MISSION® esiRNA

targeting human IL33

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TTTTGCTTTGGAGGATGAAAGTTATGAGATATATGTTGAAGACTTGAAAAAAGATGAAAAGAAAGATAAGGTGTTACTGAGTTACTATGAGTCTCAACACCCCTCAAATGAATCAGGTGACGGTGTTGATGGTAAGATGTTAATGGTAACCCTGAGTCCTACAAAAGACTTCTGGTTGCATGCCAACAACAAGGAACACTCTGTGGAGCTCCATAAGTGTGAAAAACCACTGCCAGACCAGGCCTTCTTTGTCCTTCATAATATGCACTCCAACTGTGTTTCATTTGAATGCAAGACTGATCCTGGAGTGTTTATAGGTGTAAAGGATAATCATCTTGCTCTGATTAAAGTAGACTCTTCTGAGAATTTGTGTACTGAAAATATCTTGTTTAAGCTCTCTGAAACTTAGTTGATGGAAACCTGTGAGTCTTGGG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Dongmin Shao et al.
Biochemical and biophysical research communications, 451(1), 8-14 (2014-07-09)
Idiopathic pulmonary arterial hypertension (IPAH) is an incurable condition leading to right ventricular failure and death and inflammation is postulated to be associated with vascular remodelling. Interleukin (IL)-33, a member of the "alarmin" family can either act on the membrane
Meng Li et al.
International journal of molecular sciences, 22(5) (2021-03-07)
Short-chain fatty acids (e.g., butyrate and propionate) are able to diminish endothelial cell activation. The aim of this study was to investigate whether intracellular IL-33 mediates the effects of butyrate and propionate on TNFα-induced IL-8 production and vascular cell adhesion
Weronika Gonciarz et al.
International journal of molecular sciences, 21(5) (2020-03-11)
Interleukin (IL)-33 is a proinflammatory mediator that alerts the host immune system to disorders in tissue homeostasis. Aim. To understand the role of IL-33 in modulating gastric tissue cell growth affected by Helicobacter pylori (H. pylori). Methods. IL-33 production in
Haiyan Hu et al.
Biochemical and biophysical research communications, 485(3), 643-650 (2017-02-22)
Breast cancers with estrogen receptor (ER) expressions account for the majority of all clinical cases. Due to hormone therapy with tamoxifen, prognoses of patients with ER-positive breast cancer are significantly improved. However, endocrine resistance to tamoxifen is common and inevitable
Supaporn Yangngam et al.
Journal of Cancer, 11(22), 6571-6581 (2020-10-14)
Interleukin 33 (IL-33) promotes cholangiocarcinoma (CCA) genesis in a mouse model, however, its function in human CCA has not been clearly understood. This study was aimed to investigate IL-33 level in CCA tissues and its clinicopathological correlations. The results revealed

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique