Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

View All Documentation

EHU007981

Sigma-Aldrich

MISSION® esiRNA

targeting human ALOX12

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CACCAAGGAAGATGTGACGATGGCCACAGTGATGGGGTCACTACCTGATGTCCGGCAGGCCTGTCTTCAAATGGCCATCTCATGGCATCTGAGTCGCCGCCAGCCAGACATGGTGCCTCTGGGGCACCACAAAGAAAAATATTTCTCAGGCCCCAAGCCCAAAGCTGTGCTAAACCAATTCCGAACAGATTTGGAAAAGCTGGAAAAGGAGATTACAGCCCGGAATGAGCAACTTGACTGGCCCTATGAATATCTGAAGCCCAGCTGCATAGAGAACAGTGTCACCATCTGAGCCCTAGAGTGACTCTACCTGCAAGATTTCACATCAGCTTTAGGACTGACATTTCTATCTTGAATTTCATGCTTTCCTAAAGTCTCTGCTGCTAAGGCTCTATTTCCTCCCCCAGTTAAACCCCCTACATTAGTATCCCACTAGCCCAGGGGAGCAGTAAACTTTCTCTGCAAAGACTAGATCCTTTTTTACGCTTTGCAGACCGCATAGTCACTGTCTCAACTACTCAGCTCTCCTGCTGCA

Numéro d'accès Ensembl | humain

ENSG00000108839

Numéro d'accès NCBI

NM_000697

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... ALOX12(239) , ALOX12(239)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

William H Witola et al.
Infection and immunity, 82(7), 2670-2679 (2014-04-02)
ALOX12 is a gene encoding arachidonate 12-lipoxygenase (12-LOX), a member of a nonheme lipoxygenase family of dioxygenases. ALOX12 catalyzes the addition of oxygen to arachidonic acid, producing 12-hydroperoxyeicosatetraenoic acid (12-HPETE), which can be reduced to the eicosanoid 12-HETE (12-hydroxyeicosatetraenoic acid).
Ji-Li Li et al.
Biochemical and biophysical research communications, 516(3), 991-998 (2019-07-07)
Spinal cord injury (SCI) is terrible damage leading to the deficiencies and results in infinite inconvenience to sufferers. The effective treatment for SCI still meets a larger number of problems. Herein, the underlying molecular mechanism and novel therapy of SCI
Zhen Huang et al.
Biochemical and biophysical research communications, 514(1), 24-30 (2019-04-25)
Arachidonate lipoxygenase12 (Alox12) and its metabolites 12S-hydroxyeicosatetraenoic acid (12S-HETE) have been implicated in influencing tumor transformation and progression. In this study, we have systematically evaluated the expression, function and the downstream effectors of Alox12 in breast cancer using loss- and

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique