Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU007651

Sigma-Aldrich

MISSION® esiRNA

targeting human PDK4

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGAGACTCGCCAACATTCTGAAGGAAATTGATATCCTCCCGACCCAATTAGTAAATACCTCTTCAGTGCAATTGGTTAAAAGCTGGTATATACAGAGCCTGATGGATTTGGTGGAATTCCATGAGAAAAGCCCAGATGACCAGAAAGCATTATCAGACTTTGTAGATACACTCATCAAAGTTCGAAATAGACACCATAATGTAGTCCCTACAATGGCACAAGGAATCATAGAGTATAAAGATGCCTGTACAGTTGACCCAGTCACCAATCAAAATCTTCAATATTTCTTGGATCGATTTTACATGAACCGTATTTCTACTCGGATGCTGATGAACCAGCACATTCTTATATTTAGTGACTCACAGACAGGAAACCCAAGCCACATTGGAAGCATTGATCCTAACTGTGATGTGGTAGCAGTGGTCCAAGATGCCTTTGAGTGTTCAAGGATGCTCTGTGATCAGTATTATTTATCATCTCCAGAATTAAAGCTTACACAAGTGAATGGAAAATTTCCAGACCAACCAATTCACA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

12 - Non Combustible Liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yongchang Miao et al.
Cancer medicine, 9(19), 7231-7243 (2020-08-12)
Gastric cancer (GC) is one of the most deadly malignancies at global scale, and is particularly common in eastern Asia. MicroRNA-5683 (miR-5683) was confirmed to be downregulated in GC by analyzing data from the Cancer Genome Atlas. We packaged miR-5683-mimics
D Leclerc et al.
British journal of cancer, 116(7), 930-936 (2017-02-17)
Cancer cells maintain high rates of glycolysis. Pyruvate dehydrogenase kinases (PDK) contribute to this phenomenon, which favours apoptosis resistance and cellular transformation. We previously reported upregulation of PDK4 in normal mucosa of colorectal cancer (CRC) patients compared with controls and
Xiaohui Liu et al.
Scientific reports, 7(1), 8474-8474 (2017-08-18)
Pyruvate dehydrogenase kinase (PDK) is known as a gatekeeper directing the carbon flux into glycolysis via inhibition of the pyruvate dehydrogenase complex. During syncytialization of placental trophoblasts, both ATP production and oxygen consumption are increased to meet enhanced energetic demands
Peng Zhang et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 32(7), 3924-3935 (2018-03-06)
Prostate cancer (PCa) represents one of the most common solid neoplasms, and metastasis is the second leading cause of death in adult males. Anoikis is a programmed cell death that is induced upon cell detachment from the extracellular matrix (ECM)
Yukihiro Tambe et al.
Molecular carcinogenesis, 58(10), 1726-1737 (2019-05-21)
Phosphorylation of pyruvate dehydrogenase by pyruvate dehydrogenase kinase 4 (PDK4) 4 inhibits its ability to induce a glycolytic shift. PDK4 expression is frequently upregulated in various cancer tissues, with its elevation being critical for the induction of the Warburg effect.

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique