Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU007381

Sigma-Aldrich

MISSION® esiRNA

targeting human ONECUT2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme

Sélectionner une taille de conditionnement

20 μG
195,00 €
50 μG
345,00 €

195,00 €


Date d'expédition estimée le28 avril 2025



Sélectionner une taille de conditionnement

Changer de vue
20 μG
195,00 €
50 μG
345,00 €

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

195,00 €


Date d'expédition estimée le28 avril 2025


Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCCAGCTGGAAGAAATCAACACCAAAGAGGTGGCCCAGCGCATCACAGCGGAGCTGAAGCGCTACAGTATCCCCCAGGCGATCTTTGCGCAGAGGGTGCTGTGCCGGTCTCAGGGGACTCTCTCCGACCTGCTCCGGAATCCAAAACCGTGGAGTAAACTCAAATCTGGCAGGGAGACCTTCCGCAGGATGTGGAAGTGGCTTCAGGAGCCCGAGTTCCAGCGCATGTCCGCCTTACGCCTGGCAGCGTGCAAACGCAAAGAGCAAGAACCAAACAAAGACAGGAACAATTCCCAGAAGAAGTCCCGCCTGGTGTTCACTGACCTCCAACGCCGAACACTCTTCGCCATCTTCAAGGAGAACAAACGCCCGTCAAAGGAGATGCAGATCACCATTTCCCAGCAGCTGGGCCTGGAGCTCACAACCGTCAGCAACTTCTTCATGAACGCCCGGCGCCGCAGCCTGGAGAAGTGGCAAGACGATCTGAGCACAGGGGGCTCCTCGTCCACCTCCAGCACGTGTACCAAAGCATGATGG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

G-H Wang et al.
European review for medical and pharmacological sciences, 24(18), 9378-9390 (2020-10-06)
Gastric cancer is a common malignancy, with high metastasis and poor prognosis. Our purpose was to explore potential molecular mechanisms of gastric cancer. A total of 10 pairs of gastric cancer tissues and adjacent normal gastric tissues were collected for
Meng Shen et al.
Cancer research, 79(14), 3608-3621 (2019-05-24)
Cancer-secreted, extracellular vesicle (EV)-encapsulated miRNAs enable cancer cells to communicate with each other and with noncancerous cells in tumor pathogenesis and response to therapies. Here, we show that treatment with a sublethal dose of chemotherapeutic agents induces breast cancer cells
Haiyang Guo et al.
Nature communications, 10(1), 278-278 (2019-01-19)
Neuroendocrine prostate cancer (NEPC), a lethal form of the disease, is characterized by loss of androgen receptor (AR) signaling during neuroendocrine transdifferentiation, which results in resistance to AR-targeted therapy. Clinically, genomically and epigenetically, NEPC resembles other types of poorly differentiated

Questions

Évaluations

Aucune valeur de notation

Filtres actifs

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique