Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

Voir toute la documentation

EHU005981

Sigma-Aldrich

MISSION® esiRNA

targeting human EPS8

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme

Sélectionner une taille de conditionnement

20 μG
195,00 €
50 μG
345,00 €

195,00 €

Check Cart for Availability
Toutes les photos(1)

Sélectionner une taille de conditionnement

Changer de vue
20 μG
195,00 €
50 μG
345,00 €

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

195,00 €

Check Cart for Availability

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGAATGGCTACGGATCATCACCTACCTTTTCCCAGACGGACAGAGAACATGGTTCAAAAACAAGTGCAAAGGCCCTTTATGAACAAAGGAAGAATTATGCACGGGACAGTGTCAGCAGTGTGTCAGATATATCTCAATACCGTGTTGAACACTTGACTACCTTTGTCCTGGATCGGAAAGATGCTATGATCACTGTTGATGATGGAATAAGGAAATTGAAATTGCTTGATGCCAAGGGCAAAGTGTGGACTCAAGATATGATTCTTCAAGTGGATGACAGAGCTGTGAGCCTGATTGATTTAGAATCAAAGGCAAGTAATGAACTGGAGAATTTTCCTTTAAACACAATCCAGCACTGCCAAGCTGTGATGCATTCATGCAGCTATGATTCAGTTCTTGCACTGGTGTGCAAAGAGCCAACCCAGAACAAGCCAGAT

Numéro d'accès Ensembl | humain

ENSG00000151491

Numéro d'accès NCBI

NM_004447

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... EPS8(2059) , EPS8(2059)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
DHT
QCS
DOR

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Jieyun Zhang et al.
Acta biochimica et biophysica Sinica, 52(3), 259-267 (2020-03-10)
Tumor metastasis is the main cause of treatment failure and death in patients with late stage of gastric cancer (GC). Studies showed that microRNAs (miRNAs) are important regulators in the process of tumor metastasis. In this study, we used miRNA
Quan Yuan et al.
International journal of pharmaceutics, 557, 178-181 (2019-01-01)
We developed polyamidoamine dendrimers conjugated with epidermal growth factor (EGF) for use in receptor-mediated delivery of therapeutics to cancer cells. Here, we demonstrate the utility of this approach to inhibit proliferation and migration of head and neck squamous carcinoma cells
Huifang Lu et al.
Molecular medicine reports, 14(6), 4999-5006 (2016-11-15)
Epidermal growth factor receptor pathway substrate 8 (EPS8) is critical in the proliferation, progression and metastasis of solid and hematological types of cancer, and thus constitutes an ideal target for cancer immunotherapy. The present study aimed to identify human leukocyte antigen
Haruhi Fukuhisa et al.
Journal of human genetics, 64(6), 521-534 (2019-03-13)
Our ongoing analyses identifying dysregulated microRNAs (miRNAs) and their controlled target RNAs have shed light on novel oncogenic pathways in pancreatic ductal adenocarcinoma (PDAC). The PDAC miRNA signature obtained by RNA sequencing showed that both strands of pre-miR-130b (miR-130b-5p, the
Elisa Cappellini et al.
Life sciences, 131, 30-36 (2015-04-22)
Eps8 is an actin-binding protein which has been proposed as a regulator of cancer cell motility and invasion. However, nothing much is known about its contribution to the invasive properties of endothelial cells (ECs), and more generally to angiogenesis. Expression

Questions

Évaluations

Aucune valeur de notation

Filtres actifs

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique