Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU003641

Sigma-Aldrich

MISSION® esiRNA

targeting human PGRMC1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCCTGGATAAGGAAGCACTGAAGGATGAGTACGATGACCTTTCTGACCTCACTGCTGCCCAGCAGGAGACTCTGAGTGACTGGGAGTCTCAGTTCACTTTCAAGTATCATCACGTGGGCAAACTGCTGAAGGAGGGGGAGGAGCCCACTGTGTACTCAGATGAGGAAGAACCAAAAGATGAGAGTGCCCGGAAAAATGATTAAAGCATTCAGTGGAAGTATATCTATTTTTGTATTTTGCAAAATCATTTGTAACAGTCCACTCTGTCTTTAAAACATAGTGATTACAATATTTAGAAAGTTTTGAGCACTTGCTATAAGTTTTTTAATTAACATCACTAGTGACACTAATAAAATTAACTTCTTAGAATGCATGATGTGTTTGTGTGTCACAAATCCAGAAAGTGAACTGCAGTGCTGTAATACACATGTTAATACTGTTTTTCTTCTATCTGTAGTTAGTACAGGATGAATTTAAATGTGTTTTTCCTGAGAGACAAGGAAGACTTGGGTATTTCCCAAAACAGGTAAAAATCTTAAATGTGCACCAAGAGCAAA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Diego A Pedroza et al.
British journal of cancer, 123(8), 1326-1335 (2020-07-25)
Increased expression of the progesterone receptor membrane component 1 (PGRMC1) has been linked to multiple cancers, including breast cancer. Despite being a regulatory receptor and a potential therapeutic target, the oncogenic potential of PGRMC1 has not been studied. The impact
Domenica Roberto et al.
The Prostate, 79(15), 1777-1788 (2019-09-11)
Gleason grade is among the most powerful clinicopathological classification systems used to assess risk of lethal potential in prostate cancer, yet its biologic basis is poorly understood. Notably, pure low-grade cancers, comprised predominantly of Gleason pattern 3 (G3) are typically
Ying Lin et al.
Scientific reports, 10(1), 4748-4748 (2020-03-18)
In non-small-cell lung cancer, mutation of epidermal growth factor receptor (EGFR) stimulates cell proliferation and survival. EGFR tyrosine kinase inhibitors (EGFR-TKIs) such as erlotinib are used as first-line therapy with drastic and immediate effectiveness. However, the disease eventually progresses in

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique