Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU002791

Sigma-Aldrich

MISSION® esiRNA

targeting human SERPINB2, SERPINB10

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTCAGAACCCCAGGCAGTAGACTTCCTAGAATGTGCAGAAGAAGCTAGAAAAAAGATTAATTCCTGGGTCAAGACTCAAACCAAAGGCAAAATCCCAAACTTGTTACCTGAAGGTTCTGTAGATGGGGATACCAGGATGGTCCTGGTGAATGCTGTCTACTTCAAAGGAAAGTGGAAAACTCCATTTGAGAAGAAACTAAATGGGCTTTATCCTTTCCGTGTAAACTCGGCTCAGCGCACACCTGTACAGATGATGTACTTGCGTGAAAAGCTAAACATTGGATACATAGAAGACCTAAAGGCTCAGATTCTAGAACTCCCATATGCTGGAGATGTTAGCATGTTCTTGTTGCTTCCAGATGAAATTGCCGATGTGTCCACTGGCTTGGAGCTGCTGGAAAGTGAAATAACCTATGACAAACTCAACAAGTGGACCAGCAA

Numéro d'accès Ensembl | humain

ENSG00000197632

Numéro d'accès NCBI

NM_002575

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... SERPINB2(5055) , SERPINB2(5055)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Eleonora Longhin et al.
Archives of toxicology (2018-07-11)
Exposure to particulate matter (PM) has been related to the onset of adverse health effects including lung cancer, but the underlying molecular mechanisms are still under investigation. Epithelial-to-mesenchymal transition (EMT) is regarded as a crucial step in cancer progression. In
Ziqi Meng et al.
International immunopharmacology, 81, 106028-106028 (2019-12-06)
To investigate the effect of miR-200c/PAI-2 on macrophage polarization into M2-type TAMs in TNBC. PAI-2 expression in MDA-MB-231con, MDA-MB-231miR-200ab and MDA-MB-231miR-200c breast cancer cells was evaluated by RT-PCR and immunofluorescence (IF), while the expression of the TAM marker F4/80 and
Tiefeng Jin et al.
Oncotarget, 8(20), 32769-32782 (2017-04-22)
The microRNA-200 (miR-200) family is associated with tumor metastasis and poor patient prognosis. We found that miR-200c/141 cluster overexpression upregulated SerpinB2 in the MDA-MB-231 triple-negative (TN) breast cancer cell line. We observed transcription factor (c-Jun, c-Fos, and FosB) upregulation, nuclear
Lei Hu et al.
Cell death & disease, 11(3), 172-172 (2020-03-07)
Mesenchymal stem cell (MSCs) transplantation has been used to treat Sjögren's syndrome (SS) based on the immunoregulatory properties of MSCs. However, the effectiveness need improving and its underlying intrinsic mechanisms remain largely unknown. Here, we show that Id3 is upregulated
Na-Hee Lee et al.
Cell death & disease, 9(7), 724-724 (2018-06-22)
The toxicological evaluation of potential drug candidates is very important in the preclinical phase of drug development. Toxic materials may cause serious decline in stem cell function and loss of stemness. Indeed, we found that toxic exposure more profoundly suppressed
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique