Skip to Content
Merck
All Photos(1)

Key Documents

EMU090361

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Timp2

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
€195.00
50 μG
€345.00

€195.00


Estimated to ship onMay 30, 2025



Select a Size

Change View
20 μG
€195.00
50 μG
€345.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

€195.00


Estimated to ship onMay 30, 2025


description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATCTATGGCAACCCCATCAAGAGGATTCAGTATGAGATCAAGCAGATAAAGATGTTCAAAGGACCTGACAAAGACATCGAGTTTATCTACACGGCCCCCTCTTCAGCAGTGTGCGGGGTCTCGCTGGACGTTGGAGGAAAGAAGGAGTATCTAATTGCAGGAAAGGCAGAAGGAGATGGCAAGATGCACATTACCCTCTGTGACTTCATTGTGCCCTGGGACACGCTTAGCATCACCCAGAAGAAGAGCCTGAACCACAGGTACCAGATGGGCTGTGAGTGCAAGATCACTCGCTGTCCCATGATCCCTTGCTACATCTCCTCCCCGGATGAGTGCCTCTGGATGGACTGGGTCACAGAGAAGAGCATCAATGGGCACCAGGCCAAGTTCTTCGCCTGCATCAAGAGAAGTGATGGTTCTTGCGCGTGGTACCGCGGGGCGGCACCCCCCAAGCAAGAGTTTCTTGACATCGAGGACCCGTAAGAAGGCTGACAGAGCCCCTGTGGCCAATTGAAAAGCCTCTGAGGGTTTAGACTGGTCCAGCTTTGACATCCCTTCCTGGA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

An Yan et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 37(1), 55-66 (2015-08-19)
The aim of this study was to investigate the role of microRNA miR-761 in the progression and metastasis of non-small cell lung cancer (NSCLC), and the mechanisms by which miR-761 regulates cell proliferation and metastatic activity of NSCLC cell lines.
Qinhong Xu et al.
Oncotarget, 6(16), 14153-14164 (2015-04-18)
MicroRNAs are involved in the initiation and progression of pancreatic cancer. In this study, we showed that miR-221/222 is overexpressed in pancreatic cancer. MiR-221/222 overexpression significantly promoted pancreatic cancer cell proliferation and invasion while inhibiting apoptosis. The expression of the

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service