Skip to Content
Merck
All Photos(1)

Documents

EMU055151

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Hdac6

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGGTACTTCCCATCGCCTATGAGTTTAACCCAGAACTGGTGCTGATCTCAGCTGGCTTTGATGCTGCACAAGGGGATCCGCTGGGGGGCTGCCAAGTAACACCGGAAGGTTATGCCCACCTCACCCACCTACTGATGGGCCTTGCTGGTGGCCGTATTATTCTTATTCTAGAGGGTGGATACAATTTGGCATCTATCTCTGAGTCTATGGCTGCCTGCACCCATTCCCTCCTTGGAGACCCACCACCCCAGCTTACTTTGCTGCGACCGCCACAGTCAGGAGCCCTGGTTTCAATCAGTGAGGTCATCCAAGTCCATCGCAAATACTGGCGCAGTTTGCGGTTGAGTAAAATGGAAGACAAGGAAGAATGCTCTAGTTCTAGGCTTGTCGTCAAGAAGTTGCCCCCAACAGCCAGTCCTGTATCAGCTAAGGAAATGACCACACCGAAAGGAAAGGTTCCTGAAGAAAGCGTGAGGAAGACCA

Ensembl | mouse accession no.

ENSMUSG00000031161

NCBI accession no.

NM_010413

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... HDAC6(15185) , Hdac6(15185)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Smita Salian-Mehta et al.
The Journal of biological chemistry, 290(22), 14045-14056 (2015-04-16)
The impact of histone deacetylases (HDACs) in the control of gonadotropin releasing hormone (GnRH) neuronal development is unknown. We identified an increase in many HDACs in GT1-7 (differentiated) compared with NLT (undifferentiated) GnRH neuronal cell lines. Increased HDAC9 mRNA and
Regina Kanski et al.
Journal of cell science, 127(Pt 20), 4368-4380 (2014-08-17)
Glial fibrillary acidic protein (GFAP) is the main intermediate filament in astrocytes and is regulated by epigenetic mechanisms during development. We demonstrate that histone acetylation also controls GFAP expression in mature astrocytes. Inhibition of histone deacetylases (HDACs) with trichostatin A
Yixuan Li et al.
Molecular and cellular biology, 35(20), 3547-3565 (2015-08-05)
Histone deacetylase (HDAC) inhibition leads to cell cycle arrest in G1 and G2, suggesting HDACs as therapeutic targets for cancer and diseases linked to abnormal cell growth and proliferation. Many HDACs are transcriptional repressors. Some may alter cell cycle progression
María-Soledad Valera et al.
Retrovirology, 12, 53-53 (2015-06-25)
Human immunodeficiency virus type 1 (HIV-1) has evolved a complex strategy to overcome the immune barriers it encounters throughout an organism thanks to its viral infectivity factor (Vif), a key protein for HIV-1 infectivity and in vivo pathogenesis. Vif interacts

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service