Skip to Content
Merck
All Photos(1)

Key Documents

EHU154291

Sigma-Aldrich

MISSION® esiRNA

targeting human ERCC4

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
€195.00
50 μG
€345.00

€195.00


Estimated to ship onApril 18, 2025



Select a Size

Change View
20 μG
€195.00
50 μG
€345.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

€195.00


Estimated to ship onApril 18, 2025


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTGGAGCCAAGATACGTGGTTCTTTATGACGCAGAGCTAACCTTTGTTCGGCAGCTTGAAATTTACAGGGCGAGTAGGCCTGGGAAACCTCTGGTTTACTTTCTTATATACGGAGGTTCAACTGAGGAACAACGCTATCTCACTGCTTTGCGGAAAGAAAAGGAAGCTTTTGAAAAACTCATAAGGGAAAAAGCAAGCATGGTTGTCCCTGAAGAAAGAGAAGGCAGAGATGAAACAAACTTAGACCTAGTAAGAGGCACAGCATCTGCAGATGTTTCCACTGACACTCGGAAAGCCGGTGGCCAGGAACAGAATGGTACACAGCAAAGCATAGTTGTGGATATGCGTGAATTTCGAAGTGAGCTTCCATCTCTGATCCATCGTCGGGGCATTGACATTGAACCCGTGACTTTAGAGGTTGGAGATTACATCCTCACTCCAGAAATGTGCGTGGAGCGCAAGAGTATCAGTGATTTAATCGGCTCTTTAAATAACGGCCGCCTCTACAGCCAGTGCATCTCCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Barbara Steurer et al.
Nucleic acids research, 47(7), 3536-3549 (2019-01-31)
UV light induces cyclobutane pyrimidine dimers (CPDs) and pyrimidine-pyrimidone (6-4) photoproducts (6-4PPs), which can result in carcinogenesis and aging, if not properly repaired by nucleotide excision repair (NER). Assays to determine DNA damage load and repair rates are invaluable tools
Katia A Mesquita et al.
Gynecologic oncology, 153(2), 416-424 (2019-02-25)
PARP inhibitor maintenance therapy in platinum sensitive sporadic ovarian cancers improves progression free survival. However, biomarker for synthetic lethality in platinum sensitive sporadic disease is yet to be defined. ERCC1-XPF heterodimer is a key player in nucleotide excision repair (NER)
Haiqing Fu et al.
Nature communications, 6, 6746-6746 (2015-04-17)
The Mus81 endonuclease resolves recombination intermediates and mediates cellular responses to exogenous replicative stress. Here, we show that Mus81 also regulates the rate of DNA replication during normal growth by promoting replication fork progression while reducing the frequency of replication

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service