Skip to Content
Merck
All Photos(1)

Key Documents

EHU105591

Sigma-Aldrich

MISSION® esiRNA

targeting human PTPN11

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
€195.00
50 μG
€345.00

€195.00


Estimated to ship onMay 24, 2025



Select a Size

Change View
20 μG
€195.00
50 μG
€345.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

€195.00


Estimated to ship onMay 24, 2025


description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AATTTGCCACTTTGGCTGAGTTGGTCCAGTATTACATGGAACATCACGGGCAATTAAAAGAGAAGAATGGAGATGTCATTGAGCTTAAATATCCTCTGAACTGTGCAGATCCTACCTCTGAAAGGTGGTTTCATGGACATCTCTCTGGGAAAGAAGCAGAGAAATTATTAACTGAAAAAGGAAAACATGGTAGTTTTCTTGTACGAGAGAGCCAGAGCCACCCTGGAGATTTTGTTCTTTCTGTGCGCACTGGTGATGACAAAGGGGAGAGCAATGACGGCAAGTCTAAAGTGACCCATGTTATGATTCGCTGTCAGGAACTGAAATACGACGTTGGTGGAGGAGAACGGTTTGATTCTTTGACAGATCTTGTGGAACATTATAAGAAGAATCCTATGGTGGAAACATTGGGTACAGTACTACAACTCAAGCAGCCCCTTAACACGACTCGTATAAATGCTGCTGAAATAGAAAGCAGAGTTCGAGAACTAAGCAAATTAGCTGAGACCACAGATAAAGTCAAACAAGGCTTTTGGGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Toru Mitsumori et al.
Experimental hematology, 42(9), 783-792 (2014-05-28)
The hypoxic microenvironment of the bone marrow, known as the hypoxic niche, supports hematopoietic stem cell quiescence and maintains long-term repopulation activity. Hypoxia also affects the expansion of progenitor cells and enhances erythropoiesis and megakaryopoiesis. In contrast to the known
Hsueh-Chun Wang et al.
BMC cancer, 14, 442-442 (2014-06-17)
Tumor invasion and metastasis represent a major unsolved problem in cancer pathogenesis. Recent studies have indicated the involvement of Src-homology 2 domain-containing tyrosine phosphatase 2 (SHP2) in multiple malignancies; however, the role of SHP2 in oral cancer progression has yet
Rong-Ping Zhou et al.
Molecular medicine reports, 11(6), 4489-4495 (2015-01-31)
Chlorogenic acid (CGA) exhibits various biological properties, including the inhibition of oxidation, obesity, apoptosis and tumorigenesis. CGA is also able to promote cell survival and proliferation. The aim of the present study was to determine the effects and underlying molecular
K S Siveen et al.
British journal of cancer, 111(7), 1327-1337 (2014-08-08)
Constitutive activation of signal transducer and activator of transcription signalling 3 (STAT3) has been linked with survival, proliferation and angiogenesis in a wide variety of malignancies including hepatocellular carcinoma (HCC). We evaluated the effect of lupeol on STAT3 signalling cascade

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service