Skip to Content
Merck
All Photos(1)

Key Documents

EHU089831

Sigma-Aldrich

MISSION® esiRNA

targeting human MIA3 (1)

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
€195.00
50 μG
€345.00

€195.00


Estimated to ship onApril 12, 2025



Select a Size

Change View
20 μG
€195.00
50 μG
€345.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

€195.00


Estimated to ship onApril 12, 2025


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAGAGAGAACAGAATGTCAAGAATCAGGACTTGTTGCAGCAGGAAATCGAAGACTGGAGTAAATTACATGCTGAGCTCAGTGAGCAAATCAAATCATTTGAGAAGTCTCAGAAAGATTTGGAAGTAGCTCTTACTCACAAGGATGATAATATTAATGCTTTGACTAACTGCATTACACAGTTGAATCTGTTAGAGTGTGAATCTGAATCTGAGGGTCAAAATAAAGGTGGAAATGATTCAGATGAATTAGCAAATGGAGAAGTGGGAGGTGACCGGAATGAGAAGATGAAAAATCAAATTAAGCAGATGATGGATGTCTCTCGGACACAGACTGCAATATCGGTAGTTGAAGAGGATCTAAAGCTTTTACAGCTTAAGCTAAGAGCCTCCGTGTCCACTA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yabo Li et al.
Journal of the American Heart Association, 9(7), e014146-e014146 (2020-04-03)
Background Epistasis describes how gene-gene interactions affect phenotypes, and could have a profound impact on human diseases such as coronary artery disease (CAD). The goal of this study was to identify gene-gene interactions in CAD using an easily generalizable multi-stage
Jessica L Maiers et al.
Hepatology (Baltimore, Md.), 65(3), 983-998 (2017-01-01)
Fibrogenesis encompasses the deposition of matrix proteins, such as collagen I, by hepatic stellate cells (HSCs) that culminates in cirrhosis. Fibrogenic signals drive transcription of procollagen I, which enters the endoplasmic reticulum (ER), is trafficked through the secretory pathway, and
Joan Chang et al.
Nature cell biology, 22(1), 74-86 (2020-01-08)
Collagen is the most abundant secreted protein in vertebrates and persists throughout life without renewal. The permanency of collagen networks contrasts with both the continued synthesis of collagen throughout adulthood and the conventional transcriptional/translational homeostatic mechanisms that replace damaged proteins

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service