Skip to Content
Merck
All Photos(1)

Key Documents

EHU065291

Sigma-Aldrich

MISSION® esiRNA

targeting human NFAT5

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATCCTATTGCCGATGCTCAGAACCTTTCCCAGGAAACTCAAGGTTCTCTCTTTCATAGTCCAAATCCTATTGTCCACAGTCAGACTTCTACAACCTCCTCTGAACAAATGCAGCCTCCAATGTTTCACTCTCAAAGTACCATTGCTGTGTTACAGGGCTCTTCAGTTCCTCAAGACCAGCAGTCAACCAACATATTTCTTTCCCAGAGTCCCATGAATAATCTTCAGACTAACACAGTAGCCCAAGAAGCATTTTTTGCAGCACCGAACTCAATTTCTCCACTTCAGTCAACATCAAACAGTGAACAACAAGCTGCTTTCCAACAGCAAGCTCCAATATCACACATCCAGACTCCTATGCTTTCCCAAGAACAGGCACAACCCCCGCAGCAGGGTTTATTTCAGCCTCAGGTGGCCCTGGGCTCCCTTCCACCTAATCCAATGCCTCAAAGCCAACAAGGAACCAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Sandrine Herbelet et al.
International journal of molecular sciences, 21(21) (2020-10-30)
Duchenne muscular dystrophy (DMD) is characterized by chronic inflammation and fibrotic tissue production by fibroblasts. The promyogenic factor nuclear factor of activated T-cells 5 (NFAT5) is virtually present in all cells, responding to hyperosmolar or pro-inflammatory stress. In embryogenic fibroblasts
Saseong Lee et al.
Journal of immunology (Baltimore, Md. : 1950), 201(2), 359-370 (2018-05-26)
Fibroblast-like synoviocytes (FLSs) play a key role in the progression of rheumatoid arthritis (RA) as a primary component of invasive hypertrophied pannus. FLSs of RA patients (RA-FLSs) exhibit cancer-like features, including promigratory and proinvasive activities that largely contribute to joint
Sandrine Herbelet et al.
International journal of molecular sciences, 21(23) (2020-12-09)
Glucocorticoids are drugs of choice in Duchenne muscular dystrophy (DMD), prolonging patients' ambulation. Their mode of action at the protein level is not completely understood. In DMD, muscle tissue is replaced by fibrotic tissue produced by fibroblasts, reducing mobility. Nuclear
Moritz Veltmann et al.
PloS one, 11(1), e0147312-e0147312 (2016-01-23)
Although systemic hypertension is a risk factor of age-related macular degeneration, antihypertensive medications do not affect the risk of the disease. One condition that induces hypertension is high intake of dietary salt resulting in increased blood osmolarity. In order to
Wei He et al.
Nature communications, 11(1), 1732-1732 (2020-04-09)
High-salt diets are associated with an elevated risk of autoimmune diseases, and immune dysregulation plays a key role in cancer development. However, the correlation between high-salt diets (HSD) and cancer development remains unclear. Here, we report that HSD increases the

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service