Skip to Content
Merck
All Photos(1)

Documents

EHU050311

Sigma-Aldrich

MISSION® esiRNA

targeting human PTGS2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCGGGAACACAACAGAGTATGCGATGTGCTTAAACAGGAGCATCCTGAATGGGGTGATGAGCAGTTGTTCCAGACAAGCAGGCTAATACTGATAGGAGAGACTATTAAGATTGTGATTGAAGATTATGTGCAACACTTGAGTGGCTATCACTTCAAACTGAAATTTGACCCAGAACTACTTTTCAACAAACAATTCCAGTACCAAAATCGTATTGCTGCTGAATTTAACACCCTCTATCACTGGCATCCCCTTCTGCCTGACACCTTTCAAATTCATGACCAGAAATACAACTATCAACAGTTTATCTACAACAACTCTATATTGCTGGAACATGGAATTACCCAGTTTGTTGAATCATTCACCAGGCAAATTGCTGGCAGGGTTGCTGGTGGTAGGAATG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ke Liao et al.
Journal of neuroimmune pharmacology : the official journal of the Society on NeuroImmune Pharmacology, 15(3), 390-399 (2019-07-22)
Long non-coding RNAs (lncRNAs), including long intergenic non-coding RNAs (lincRNAs), play an important regulatory role in controlling various biological processes. Both in vitro and in vivo studies have demonstrated that lincRNA-Cox2 plays a global regulatory role in regulating the expression
Mia Madel Alfajaro et al.
PloS one, 13(7), e0200726-e0200726 (2018-07-19)
Cyclooxygenases (COXs)/prostaglandin E2 (PGE2) signaling pathways are known to modulate a variety of homeostatic processes and are involved in various pathophysiological conditions. COXs/PGE2 signaling pathways have also been demonstrated to have proviral or antiviral effects, which appeared different even in
Sreekanth Chanickal Narayanapillai et al.
Carcinogenesis, 41(11), 1518-1528 (2020-07-01)
Chronic obstructive pulmonary disease (COPD) is a significant risk factor for lung cancer. One potential mechanism through which COPD contributes to lung cancer development could be through generation of an immunosuppressive microenvironment that allows tumor formation and progression. In this
Lei Zhang et al.
Reproduction, fertility, and development (2018-07-10)
Circular RNAs (circRNAs) have been found to play important functional roles in epigenetic regulation under certain physiological and pathological conditions. However, knowledge of circRNAs during the development of receptive endometrium (RE) from pre-RE is limited. In the RE of dairy
Bing-Wei Dong et al.
Biochemical and biophysical research communications, 503(4), 2293-2300 (2018-07-03)
Cisplatin (CDDP)-based systematic chemotherapy remains the mainstay of treatment for muscle-invasive bladder cancer (MIBC). However, acquired resistance to CDDP, a multifactorial process governed by an array of signals acting at different levels, is the major problem in BC treatment. Here

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service