Skip to Content
Merck
All Photos(1)

Key Documents

EHU046621

Sigma-Aldrich

MISSION® esiRNA

targeting human IL6

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
€195.00
50 μG
€345.00

€195.00


Estimated to ship onMay 11, 2025



Select a Size

Change View
20 μG
€195.00
50 μG
€345.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

€195.00


Estimated to ship onMay 11, 2025


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATGCAATAACCACCCCTGACCCAACCACAAATGCCAGCCTGCTGACGAAGCTGCAGGCACAGAACCAGTGGCTGCAGGACATGACAACTCATCTCATTCTGCGCAGCTTTAAGGAGTTCCTGCAGTCCAGCCTGAGGGCTCTTCGGCAAATGTAGCATGGGCACCTCAGATTGTTGTTGTTAATGGGCATTCCTTCTTCTGGTCAGAAACCTGTCCACTGGGCACAGAACTTATGTTGTTCTCTATGGAGAACTAAAAGTATGAGCGTTAGGACACTATTTTAATTATTTTTAATTTATTAATATTTAAATATGTGAAGCTGAGTTAATTTATGTAAGTCATATTTATATTTTTAAGAAGTACCACTTGAAACATTTTATGTATTAGTTTTGAAATAATAATGGAAAGTGGCTATGCAGTTTGAATATCCTTTGTTTCAGAGCCAGATCATTTCTTGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Eun-Ah Ye et al.
Vision research, 139, 15-22 (2017-04-24)
microRNA (miRNA) play critical roles in the pathological processes of diabetic retinopathy, including inflammatory responses, insulin signaling, and angiogenesis. In addition to their regulatory functions on gene expression, miRNA is considered as a potential therapeutic target, as well as a
Thi Thuy Tien Vo et al.
Journal of Cancer, 11(20), 6038-6049 (2020-09-15)
Recently, many studies have indicated that ambient air particulate matter (PM) can increase the risk of oral cancer. The most common malignant tumor in the oral cavity is oral squamous cell carcinoma (OSCC). Usually, cancer cell migration/invasion is the most
Hu Liu et al.
Biochemical and biophysical research communications, 486(2), 239-244 (2017-03-04)
Limited efficacy of immune checkpoint inhibitors in hepatocellular carcinoma (HCC) was observed in clinical trials, thus prompting investigation into combination therapy. Interleukin-6 (IL-6) has important roles in modeling immune responses in cancers. Here, we hypothesized that IL-6 blockade would enhance
HongYu Dong et al.
Journal of cellular biochemistry, 119(8), 6535-6544 (2018-02-02)
RE (Radiation enteritis) has been characterized by the inflammation reaction, and in this study, we aim to explore inflammatory cytokines and underlying mechanism involved in the pathogenesis of RE. Luciferase assay was performed to explore whether polymorphism affected the expression
Xiongyan Wu et al.
Oncotarget, 8(13), 20741-20750 (2017-02-12)
Cancer-associated fibroblasts (CAFs), as the activated fibroblasts in tumor stroma, are important modifiers of tumor progression. However, the molecular mechanisms underlying the tumor-promoting properties of CAFs in gastric cancer remain unclear. Here, we show that CAFs isolated from gastric cancer

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service