Skip to Content
Merck
All Photos(1)

Key Documents

EHU156721

Sigma-Aldrich

MISSION® esiRNA

targeting human ECM1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCCTTTGAGGGACAGAGTCAAGTGCAGCCCCCTCCCTCTCAGGAGGCCACCCCTCTCCAACAGGAAAAGCTGCTACCTGCCCAACTCCCTGCTGAAAAGGAAGTGGGTCCCCCTCTCCCTCAGGAAGCTGTCCCCCTCCAAAAAGAGCTGCCCTCTCTCCAGCACCCCAATGAACAGAAGGAAGGAACGCCAGCTCCATTTGGGGACCAGAGCCATCCAGAACCTGAGTCCTGGAATGCAGCCCAGCACTGCCAACAGGACCGGTCCCAAGGGGGCTGGGGCCACCGGCTGGATGGCTTCCCCCCTGGGCGGCCTTCTCCAGACAATCTGAACCAAATCTGCCTTCCTAACCGTCAGCATGTGGTATATGGTCCCTGGAACCTACCACAGTCCAGCTACTCCCACCTCACTCGCCAGGGTGAGACCCTCAATTTCCTGGAGATTGGATATTCCCGCTGCTGCCACTGCCGCAGCCACACAAACCGCCTAGAGT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Cuixian Li et al.
PloS one, 6(10), e27053-e27053 (2011-11-03)
Malignant gliomas represent one of the most aggressive types of cancers and their recurrence is closely linked to acquired therapeutic resistance. A combination of chemotherapy is considered a promising therapeutic model in overcoming therapeutic resistance and enhancing treatment efficacy. Herein
Lin-Qing Liu et al.
Food and chemical toxicology : an international journal published for the British Industrial Biological Research Association, 133, 110779-110779 (2019-09-01)
MicroRNAs were known to play very important roles in human diseases, and have attracted great interests of research scientists in medicine, toxicology and functional foods. Gastric carcinoma (GC) remains one of the most common and lethal types of malignancy worldwide.
Sophie Sarah Steinhaeuser et al.
Laboratory investigation; a journal of technical methods and pathology, 100(7), 928-944 (2020-03-24)
The tumor microenvironment is increasingly recognized as key player in cancer progression. Investigating heterotypic interactions between cancer cells and their microenvironment is important for understanding how specific cell types support cancer. Forming the vasculature, endothelial cells (ECs) are a prominent
Jie Chen et al.
Oncogene, 38(14), 2533-2550 (2018-12-12)
Many reports have described DGKα as an oncogene, hence, we investigated its function and the underlying mechanisms in esophageal squamous cell carcinoma (ESCC) progression. This study demonstrated that DGKα was upregulated by inflammatory stimulants and formed feedforward loop with Akt/NF-κB
Ariel E Cariaga-Martínez et al.
Biology open, 3(10), 924-936 (2014-09-14)
The acquisition of invasiveness is characteristic of tumor progression. Numerous genetic changes are associated with metastasis, but the mechanism by which a cell becomes invasive remains unclear. Expression of p85β, a regulatory subunit of phosphoinositide-3-kinase, markedly increases in advanced carcinoma

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service