Skip to Content
Merck
All Photos(1)

Key Documents

EHU131531

Sigma-Aldrich

MISSION® esiRNA

targeting human SF3B1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGTGGAGTTGGCAAACAAAGTAGGTGCAGCAGAAATTATATCCAGGATTGTGGATGATCTGAAAGATGAAGCCGAACAGTACAGAAAAATGGTGATGGAGACAATTGAGAAAATTATGGGTAATTTGGGAGCAGCAGATATTGATCATAAACTTGAAGAACAACTGATTGATGGTATTCTTTATGCTTTCCAAGAACAGACTACAGAGGACTCAGTAATGTTGAACGGCTTTGGCACAGTGGTTAATGCTCTTGGCAAACGAGTCAAACCATACTTGCCTCAGATCTGTGGTACAGTTTTGTGGCGTTTAAATAACAAATCTGCTAAAGTTAGGCAACAGGCAGCTGACTTGATTTCTCGAACTGCTGTTGTCATGAAGACTTGTCAAGAGGAAAAATTGATGGGACACTTGGGTGTTGTATTGTATGAGTATTTGGGTGAAGAGTACCCTGAAGTATTGGGCAGCAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Juan L López-Cánovas et al.
Cancer letters, 496, 72-83 (2020-10-11)
Splicing alterations represent an actionable cancer hallmark. Splicing factor 3B subunit 1 (SF3B1) is a crucial splicing factor that can be targeted pharmacologically (e.g. pladienolide-B). Here, we show that SF3B1 is overexpressed (RNA/protein) in hepatocellular carcinoma (HCC) in two retrospective
Pablo Baeza-Centurion et al.
Cell, 176(3), 549-563 (2019-01-22)
Despite a wealth of molecular knowledge, quantitative laws for accurate prediction of biological phenomena remain rare. Alternative pre-mRNA splicing is an important regulated step in gene expression frequently perturbed in human disease. To understand the combined effects of mutations during

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service