Skip to Content
Merck
All Photos(1)

Documents

EHU091961

Sigma-Aldrich

MISSION® esiRNA

targeting human FLI1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATGACCACCAACGAGAGGAGAGTCATCGTCCCCGCAGACCCCACACTGTGGACACAGGAGCATGTGAGGCAATGGCTGGAGTGGGCCATAAAGGAGTACAGCTTGATGGAGATCGACACATCCTTTTTCCAGAACATGGATGGCAAGGAACTGTGTAAAATGAACAAGGAGGACTTCCTCCGCGCCACCACCCTCTACAACACGGAAGTGCTGTTGTCACACCTCAGTTACCTCAGGGAAAGTTCACTGCTGGCCTATAATACAACCTCCCACACCGACCAATCCTCACGATTGAGTGTCAAAGAAGACCCTTCTTATGACTCAGTCAGAAGAGGAGCTTGGGGCAATAACATGAATTCTGGCCTCAACAAAAGTCCTCCCCTTGGAGGGGCACAAACGATCAGTAAGAATACAGAGCAACGGCC

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Tao He et al.
Gene, 596, 137-146 (2016-10-30)
A translocation leading to the formation of an oncogenic EWS-ETS fusion protein defines Ewing sarcoma. The most frequent gene fusion, present in 85 percent of Ewing sarcomas, is EWS-FLI1. Here, a high-throughput RNA interference screen was performed to identify genes
Jonathan P Van Beek et al.
Arthritis research & therapy, 8(2), R36-R36 (2006-02-14)
CCN2 is encoded by an immediate-early gene induced in mesenchymal cells during the formation of blood vessels, bone and connective tissue. It plays key roles in cell adhesion and migration, as well as matrix remodeling. CCN2 is overexpressed in fibrosis
Samer Kayali et al.
PloS one, 7(10), e46799-e46799 (2012-10-12)
Clonal erythroleukemia developing in susceptible mice infected by Friend virus complex are associated with highly recurrent proviral insertions at one of three loci called Spi-1, Fli-1 or Fli-3, leading to deregulated expression of oncogenic Spi-1 or Fli-1 transcription factors or
Beiping Miao et al.
International journal of cancer, 147(1), 189-201 (2019-12-18)
Binding of transcription factors to mutated DNA sequences is a likely regulator of cancer progression. Noncoding regulatory mutations such as those on the core promoter of the gene encoding human telomerase reverse transcriptase have been shown to affect gene expression
Gong-Hong Wei et al.
The EMBO journal, 29(13), 2147-2160 (2010-06-03)
Members of the large ETS family of transcription factors (TFs) have highly similar DNA-binding domains (DBDs)-yet they have diverse functions and activities in physiology and oncogenesis. Some differences in DNA-binding preferences within this family have been described, but they have

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service